ID: 982376403

View in Genome Browser
Species Human (GRCh38)
Location 4:154695798-154695820
Sequence CTGGTTACAGAAATGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982376403_982376413 20 Left 982376403 4:154695798-154695820 CCATTCCCCATTTCTGTAACCAG 0: 1
1: 0
2: 2
3: 33
4: 320
Right 982376413 4:154695841-154695863 CCTGGTTTTGGCTGTGAGACTGG 0: 1
1: 0
2: 1
3: 9
4: 223
982376403_982376408 -10 Left 982376403 4:154695798-154695820 CCATTCCCCATTTCTGTAACCAG 0: 1
1: 0
2: 2
3: 33
4: 320
Right 982376408 4:154695811-154695833 CTGTAACCAGTTTAGAGGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 111
982376403_982376411 8 Left 982376403 4:154695798-154695820 CCATTCCCCATTTCTGTAACCAG 0: 1
1: 0
2: 2
3: 33
4: 320
Right 982376411 4:154695829-154695851 TTTGGAATGTGACCTGGTTTTGG 0: 1
1: 0
2: 1
3: 29
4: 267
982376403_982376410 2 Left 982376403 4:154695798-154695820 CCATTCCCCATTTCTGTAACCAG 0: 1
1: 0
2: 2
3: 33
4: 320
Right 982376410 4:154695823-154695845 TAGAGGTTTGGAATGTGACCTGG 0: 1
1: 0
2: 1
3: 17
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982376403 Original CRISPR CTGGTTACAGAAATGGGGAA TGG (reversed) Intronic
901479430 1:9514599-9514621 CTGATTGCAGAACTGGGGCAGGG + Intergenic
902260878 1:15223896-15223918 CTGGTTGCAGTTCTGGGGAAGGG + Intergenic
903466738 1:23557157-23557179 CCTATTTCAGAAATGGGGAAAGG - Intergenic
903535946 1:24066478-24066500 CTGTTTAGATAACTGGGGAAGGG - Intronic
904036820 1:27563545-27563567 CTGGTGACAGTGATGGGGGAGGG - Intronic
905174660 1:36127914-36127936 CTGGTGACACAAACGGGCAAGGG + Intergenic
906102890 1:43274361-43274383 CTGGTTTCAGAGGTGGGGCAGGG - Intergenic
907893302 1:58657335-58657357 ATGTTTACAGAAGTGGAGAAAGG - Exonic
908326478 1:63028590-63028612 CTGGTTCCAGAAATGCTGCAAGG - Intergenic
908380312 1:63592030-63592052 CTGGTTTTGGAATTGGGGAAGGG + Intronic
908894503 1:68883167-68883189 CTGTTAACTGAGATGGGGAATGG + Intergenic
909520716 1:76565024-76565046 TTGGAAACGGAAATGGGGAAGGG - Intronic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
909971775 1:81999632-81999654 CTGATTACATAACTGTGGAAAGG - Intergenic
910332105 1:86085837-86085859 CTGGTTTCAAAAAATGGGAATGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911693391 1:100860852-100860874 CTGTTTACTGAAATGGGCTAGGG - Intergenic
912042210 1:105406115-105406137 CTGGAGACAGGAATTGGGAATGG + Intergenic
914389526 1:147207267-147207289 CTATCTACAGAGATGGGGAAAGG + Intronic
915966539 1:160313735-160313757 CTAGCTACAGAACTGGGGAAAGG + Intronic
916790683 1:168122418-168122440 CTGTTTTGAGAAAAGGGGAAGGG - Intronic
916916918 1:169417088-169417110 CTGGTTACCAAAATGGGGAAGGG + Intronic
916993155 1:170266480-170266502 ATGGTTACAGACACTGGGAAGGG - Intergenic
917018176 1:170558177-170558199 CAGGTGAGAGAACTGGGGAATGG + Intergenic
918403947 1:184193111-184193133 TTGGTCACAGTAATGGGGTAGGG + Intergenic
918474558 1:184909573-184909595 CTGGCTACAGAAATGTTGAACGG - Intronic
920448041 1:206034984-206035006 GGGGTTGCAGAAAGGGGGAAAGG + Intergenic
921254211 1:213325008-213325030 CTGGGTGCAGAAAGGGGGCAGGG - Intergenic
921841031 1:219828750-219828772 CTGGACACAGGAATGGGCAAAGG - Intronic
922597323 1:226824050-226824072 ATTGTGACAGAAATGTGGAAGGG + Intergenic
923050600 1:230388877-230388899 CAGGCCACAGAAATGGGGAAAGG + Intronic
1063102057 10:2958886-2958908 CTGGTGACAGACATGCAGAATGG + Intergenic
1063228973 10:4045084-4045106 CTGGTTAGAGAGGTGGGGTAGGG - Intergenic
1063535922 10:6883417-6883439 CTGGACACAGAACTTGGGAATGG + Intergenic
1063877852 10:10498529-10498551 CTGGTTAGAGAAATGGGACCAGG + Intergenic
1065800992 10:29352204-29352226 CTGACTGCAGAAATGGGAAAGGG + Intergenic
1066098286 10:32094061-32094083 CTAGGTAAGGAAATGGGGAAGGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067665590 10:48275144-48275166 GTGGTTAGAGAAAGGGGGAAAGG + Intergenic
1068100140 10:52542393-52542415 CTGGATAAAGATTTGGGGAATGG + Intergenic
1068345619 10:55774519-55774541 CTGACAAAAGAAATGGGGAAAGG + Intergenic
1070261943 10:74864926-74864948 CTTGTAACAGAAATTGGGATCGG + Intronic
1071057518 10:81528790-81528812 CTGTTTTGAGAAATGGGCAATGG - Intergenic
1073488022 10:103834010-103834032 CTGGTTAGAGACGTGGGGGAGGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075717549 10:124565847-124565869 CGGGTTACAGCAGTGGGGACAGG + Intronic
1075955168 10:126517351-126517373 CTGGTTAAAGAAACGGGCAGAGG + Intronic
1077223608 11:1428044-1428066 CAGAGTACAGTAATGGGGAAAGG + Intronic
1078035041 11:7794698-7794720 CTGGTCAAAGAACTGGGAAAAGG - Intergenic
1078892283 11:15567964-15567986 GGGGTTACAGGATTGGGGAAAGG + Intergenic
1081945685 11:46991681-46991703 CTTGTAACAGAGATGGGGAGGGG - Intronic
1083311762 11:61787422-61787444 ATGGGTCCAGAAATGGGAAAGGG + Exonic
1084933819 11:72576438-72576460 CTGGCTGCAGGAATGGGTAAGGG + Exonic
1084968489 11:72756613-72756635 CTGGGCACAGAAGTGGGGATGGG + Intronic
1085758111 11:79218295-79218317 TTGGCTACAAAAATGGGCAAGGG + Intronic
1085861476 11:80241077-80241099 CTGATGACAGAAATGGGTAAAGG - Intergenic
1087048221 11:93862138-93862160 TTGGTTATAGAAAAGGGAAAAGG + Intergenic
1090557521 11:127892517-127892539 CTTTTTACAAAAATGGGGAGTGG - Intergenic
1093399779 12:18731639-18731661 TTGGTTACACAAACTGGGAAAGG - Intronic
1099663279 12:85594267-85594289 CTGACTAAAGCAATGGGGAAAGG - Intergenic
1100434490 12:94559437-94559459 CTGGTTAGAAAGAGGGGGAATGG + Intergenic
1101111561 12:101491532-101491554 CTGCTTACAGAAATGGGCTTTGG - Intergenic
1101396168 12:104349930-104349952 CTGTGTAAAGAAATGGGAAAAGG + Exonic
1101540213 12:105658328-105658350 CTGGGGAGATAAATGGGGAATGG + Intergenic
1102061401 12:109934679-109934701 ATGGTTTAAAAAATGGGGAAAGG - Intronic
1102270290 12:111528616-111528638 TTCGAGACAGAAATGGGGAAGGG + Intronic
1103892066 12:124246771-124246793 TCTGTTACAGAAACGGGGAAGGG + Intronic
1104245399 12:127035384-127035406 CTGGTTGTAGAACTGGGGTAAGG + Intergenic
1104570238 12:129918572-129918594 CTGATTGCAGAAGTAGGGAATGG + Intergenic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1106032715 13:26017316-26017338 CTTGTTAAAGAACTGGAGAATGG + Intronic
1106353853 13:28959887-28959909 CTGGCAGAAGAAATGGGGAAGGG - Intronic
1107085393 13:36422122-36422144 TTAATTACAGAAATGAGGAAAGG - Intergenic
1107725990 13:43299719-43299741 TTGCTTACACAAGTGGGGAATGG - Intronic
1108906069 13:55475575-55475597 CTGGTTACAGAATGGGCAAAGGG - Intergenic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109427908 13:62191806-62191828 GTGGTTAGAGAAATGGGGGTGGG + Intergenic
1109741783 13:66563218-66563240 CTGTTTAGAGAACTGGGAAATGG - Intronic
1110660318 13:78053211-78053233 TTTGGTAGAGAAATGGGGAAAGG - Intergenic
1111094721 13:83497824-83497846 CTGGTTAAAGTAATGGAGATGGG + Intergenic
1111410750 13:87873582-87873604 CTAGGTACAGAAACTGGGAAAGG - Intergenic
1112218025 13:97456011-97456033 CTGGCTAGAGAACTGGGAAATGG - Intronic
1116613397 14:47105701-47105723 CTGGTCACAGAGATTAGGAAGGG - Intronic
1118942454 14:70350061-70350083 TTGGTTATAGAAAAGGGAAAAGG - Intronic
1118969033 14:70616357-70616379 CTGGGGAGAGAAATGAGGAAGGG + Intergenic
1119109399 14:71957523-71957545 CTATTTACAGAAATGTTGAAAGG + Intronic
1119198257 14:72733337-72733359 CTATTTACAGAGATGGGGAGAGG + Intronic
1119904660 14:78290677-78290699 ATGTTTACAGGAAAGGGGAAGGG - Intronic
1122098371 14:99387763-99387785 CAGGTGACAGAAATGGGGTTTGG - Intergenic
1123768222 15:23502890-23502912 GTGGTTACAGAAAAGGGGAGTGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126412068 15:48382377-48382399 CAGGTTGAAGAAATGGGGAATGG + Intergenic
1126426885 15:48537386-48537408 CTGGGGTCAGAAAGGGGGAATGG + Intronic
1126617383 15:50598587-50598609 ATGGTTACAGACAAGGGGGATGG - Intronic
1126915886 15:53466005-53466027 CTGATTGTAGAAATGGGAAAAGG + Intergenic
1127025617 15:54802321-54802343 CTGATCACAGAAATGTGGACTGG - Intergenic
1127471110 15:59291136-59291158 CTGGTTGCAAAAATGCTGAAAGG + Intronic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1129179320 15:73862306-73862328 CTGGTCAGAGGAATTGGGAAAGG + Intergenic
1131283233 15:91037948-91037970 CTGGCTACAATGATGGGGAAGGG - Intergenic
1132497057 16:268915-268937 CTGGTTTTAGAGATGGGGATGGG + Exonic
1133941418 16:10312362-10312384 TTGGATTCTGAAATGGGGAAGGG - Intergenic
1135013655 16:18905911-18905933 CTGGTTAAAGAAGTGAGGAAGGG - Intronic
1135320598 16:21493480-21493502 CTGGTTAAAGAAGTGAAGAAGGG - Intergenic
1135373433 16:21924970-21924992 CTGGTTAAAGAAGTGAAGAAGGG - Intergenic
1135385082 16:22031954-22031976 CTGGTAACAGAAATGGAAAATGG - Intronic
1135438356 16:22445732-22445754 CTGGTTAAAGAAGTGAAGAAGGG + Intergenic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136330813 16:29575179-29575201 CTGGTTAAAGAAGTGAAGAAGGG - Intergenic
1136445448 16:30314907-30314929 CTGGTTAAAGAAGTGAAGAAGGG - Intergenic
1136610731 16:31363381-31363403 CTAGTGACAGAAATGGGACACGG - Intronic
1137591209 16:49695052-49695074 CTCGGTGCAGAACTGGGGAATGG - Intronic
1137937030 16:52644669-52644691 CTGGTAACAGAAGTGCTGAAGGG + Intergenic
1138457439 16:57129450-57129472 CTGCTTACTGAGATGAGGAACGG + Intronic
1139003319 16:62540734-62540756 CTGATAACTGAAGTGGGGAACGG - Intergenic
1139556026 16:67711030-67711052 CTGGTTACTGCTCTGGGGAAGGG - Intronic
1139974915 16:70801797-70801819 CTGGTTACAGACAGAGAGAAAGG + Intergenic
1141306849 16:82872751-82872773 CTGGAGATAGAAATAGGGAATGG + Intronic
1142265336 16:89061843-89061865 CTGGTTACCGAAAGGGCGAAGGG + Intergenic
1143259129 17:5585051-5585073 CTGCTTGCAGGAATGAGGAAGGG - Intronic
1143970894 17:10794833-10794855 CAGGTTAAACAAATGGGAAAAGG + Intergenic
1144396198 17:14845626-14845648 CTTGTTACAGAAATTCAGAAGGG + Intergenic
1146589345 17:34115025-34115047 CTGGTCACTGAAATGAGCAACGG - Intronic
1147557905 17:41491192-41491214 CAGGTCACAGAAATGGCCAATGG + Intronic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1151643559 17:75414213-75414235 CAGGTGACAGAAATGGGGCCAGG - Intergenic
1152377655 17:79927009-79927031 CTGGTTCCTGAAATGGGCACTGG + Intergenic
1155295369 18:24380127-24380149 CTGGTTATAGAATTGGGGATTGG - Intronic
1157052993 18:44191247-44191269 CTGGTGCCTGAAATTGGGAAGGG - Intergenic
1157234459 18:45951095-45951117 CTGGCTGCAGAAATTGGTAAGGG - Exonic
1157240139 18:46001417-46001439 TTGGTTAAAAAAATGGGCAACGG - Intronic
1157569657 18:48704028-48704050 CTGAGTACAGAAATGAGGGAGGG + Intronic
1157920629 18:51709763-51709785 TTGGTTATAGAAAAGGGAAAAGG - Intergenic
1158038854 18:53068828-53068850 CTGATTGCAAAAATGGGAAATGG + Intronic
1159885326 18:73898076-73898098 CTGGGAACAGAAGTGGGGACGGG - Intergenic
1160456063 18:79001622-79001644 CTTGGTACAGAAATGCTGAAAGG - Intronic
1161592928 19:5136832-5136854 CTGGGTCTGGAAATGGGGAAAGG - Intronic
1161961305 19:7524893-7524915 CTGGTTGGAGAAAGGGGAAAAGG + Intronic
1162119644 19:8455559-8455581 CTGGTTAAAGAAAAAGGTAATGG + Exonic
1163421262 19:17214893-17214915 CAGGCTACAGAAATCGGGAAGGG + Intergenic
1164463980 19:28471918-28471940 CTGGCCTCAGAAAAGGGGAAGGG + Intergenic
1165128470 19:33617663-33617685 GAGGTGACAGAAAAGGGGAAAGG + Intergenic
1165154142 19:33777297-33777319 CGGGATCCAGAAATGGGCAAAGG + Intergenic
1165952318 19:39481203-39481225 GTGGTCACTGAAACGGGGAACGG - Intronic
1166111175 19:40623869-40623891 CTGGGAAGAGAAATGGGAAAGGG + Intronic
1167367854 19:49064296-49064318 CTCGGTACAGGAAAGGGGAAGGG + Intronic
1168495347 19:56843220-56843242 CTGTTTATAGAAATGGGGAAAGG - Intergenic
925326351 2:3024773-3024795 ATGGCTACAGAGATGGGGAGGGG - Intergenic
926347372 2:11960212-11960234 CTGATGAAAGCAATGGGGAATGG + Intergenic
926814889 2:16790409-16790431 CAGGTTTCAGAAATTTGGAAAGG - Intergenic
928985534 2:37177524-37177546 GTGGTTACAGGGATGGGGAAGGG + Intronic
928996032 2:37292187-37292209 CTCTTTACAGAAATGGGGGTGGG + Intronic
929162564 2:38847220-38847242 CTGGTAACAGAAATTGGAAAGGG + Intronic
929950552 2:46406583-46406605 TTGGTTACAGTCATGGGGACAGG + Intergenic
929995940 2:46826259-46826281 CTGGTTCCTGAAGAGGGGAAAGG - Intronic
931248326 2:60509304-60509326 TTCTTTCCAGAAATGGGGAAAGG + Intronic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
933147824 2:78876910-78876932 GTGGTTAAAGAAATGGTGACAGG - Intergenic
933155483 2:78968629-78968651 CAGGGTACAGAACTGAGGAATGG - Intergenic
933167493 2:79092432-79092454 TTGGTTATAGAAAAGGGAAAAGG + Intergenic
936480893 2:112883924-112883946 CTGGTGACATCACTGGGGAATGG + Intergenic
936854456 2:116939725-116939747 CTGGTGAAAGAAAATGGGAAGGG - Intergenic
938254732 2:129847737-129847759 CTCATTTCAGAAATGGGAAATGG - Intergenic
939227927 2:139387065-139387087 CTGGTCACACATATGGGCAATGG + Intergenic
939562191 2:143745257-143745279 ATGGGTTCAGGAATGGGGAATGG - Intronic
939867593 2:147490901-147490923 CTGGTTATAGAAAACAGGAAAGG - Intergenic
941735859 2:168976460-168976482 CTGTTTCCAGTAATAGGGAATGG - Intronic
942488139 2:176461005-176461027 ATGGTTATAAAAATGGGTAATGG - Intergenic
942607815 2:177710418-177710440 CTGCTAAGAGCAATGGGGAATGG + Intronic
943606523 2:189983558-189983580 CTGGGAACAGATGTGGGGAAGGG - Intronic
944590314 2:201210732-201210754 CTGGGTACCGAACTGGGGACAGG + Intronic
944614611 2:201447789-201447811 CTGGGCAGAGAAAAGGGGAAGGG - Intronic
946185813 2:217979792-217979814 CTGGTTAGAGAACTGGGGAGGGG + Intronic
946567775 2:220986322-220986344 CTAATTACAGAATTGGGGATGGG + Intergenic
946668244 2:222074061-222074083 CTGTTTGCAGAAAAGAGGAAGGG - Intergenic
947589645 2:231378354-231378376 GTGATCACAGAAATGGGGAGAGG - Intergenic
947819906 2:233062288-233062310 CAGGTTACAGACATGGGGCGTGG + Intronic
948566928 2:238893352-238893374 CTGGTTACAGATATGGCTTATGG + Intronic
948840577 2:240646941-240646963 CTGTTTACAGAAATAGGCAGTGG + Intergenic
1170243471 20:14195359-14195381 TCTGATACAGAAATGGGGAAGGG + Intronic
1173785344 20:45789096-45789118 CAGGCCTCAGAAATGGGGAATGG + Intronic
1174843358 20:53920341-53920363 CAGGGTACAGAAATAGAGAAAGG + Intergenic
1175774228 20:61642820-61642842 CTGGCTTCAGAGATGGGGGAAGG - Intronic
1175994995 20:62808033-62808055 CTGGCTGGCGAAATGGGGAAGGG + Intronic
1176921106 21:14688406-14688428 CTGTTTAGAGAAATGTTGAAGGG + Intergenic
1177169031 21:17635445-17635467 CTGGTGACATAAATGATGAATGG - Intergenic
1177362303 21:20088526-20088548 TTGGTTATAGAAATGGAGACAGG + Intergenic
1178725509 21:35048018-35048040 CTGGTTTCAAAAATGGAGACAGG + Intronic
1179041260 21:37804022-37804044 CCAGTTAAAAAAATGGGGAAAGG + Intronic
1179666611 21:42917125-42917147 TTGGTTATAGAAAAGGGGAAAGG + Intergenic
1180005176 21:45017487-45017509 CTAGTCACAGAAATGGGGTTGGG + Intergenic
1180384964 22:12171456-12171478 GAGGTGAAAGAAATGGGGAAGGG + Intergenic
1181429877 22:22872808-22872830 CTGGGTACAGACATGGAGACAGG + Intronic
1181794864 22:25299751-25299773 CAAGTCAGAGAAATGGGGAAAGG - Intergenic
1182309311 22:29393445-29393467 TGGGTGACAGAAGTGGGGAAGGG + Intronic
1183275587 22:36895195-36895217 GTGGTTTTAGAAATGGGTAACGG + Intergenic
949797581 3:7867707-7867729 CCGGGAACTGAAATGGGGAATGG + Intergenic
950968695 3:17164944-17164966 CTGCTAACAGCTATGGGGAAGGG + Intronic
950992672 3:17457465-17457487 ATAGTAACAGAAATGGAGAATGG - Intronic
951569429 3:24046592-24046614 ATGGTTACAGAAATTAGAAAAGG - Intergenic
952206643 3:31186982-31187004 CTTGTTTCACAAATAGGGAAAGG - Intergenic
952542590 3:34382155-34382177 CTTGTTACAGAAAAGGCTAAAGG + Intergenic
953671649 3:44967872-44967894 CTGGCTACAGCAATGGAGATGGG + Intronic
956154646 3:66282510-66282532 CTGATTACAGGACTGGGGCAGGG - Intronic
959855508 3:111151565-111151587 CTACTTACAGAGGTGGGGAAAGG - Intronic
963242807 3:143026318-143026340 ATTGTTACAGAAAATGGGAAGGG + Intronic
963449038 3:145454125-145454147 CTGGTTGCCTAAATGAGGAATGG - Intergenic
963492453 3:146018361-146018383 CTGCTTCCAGAACTGGAGAAGGG - Intergenic
965094725 3:164210439-164210461 CTGGTTACAGAAATGGACGGTGG - Intergenic
965169935 3:165250001-165250023 ATGGTGTCAGAAATGGGGACTGG - Intergenic
967353571 3:188542781-188542803 CTGGTTACACAACTGGGAAGAGG - Intronic
967483150 3:189998470-189998492 ATGGCTACAGGAATGGGAAAGGG - Intronic
967527579 3:190513108-190513130 GGGGTTTCAGAAATGGGGACAGG + Intergenic
967552851 3:190819392-190819414 GTGGATGCAGATATGGGGAAGGG - Intergenic
967630178 3:191736530-191736552 CTGGGAACAGTAATGGGGAAGGG - Intergenic
967776226 3:193388810-193388832 GTGGTTACAAAGATGGAGAATGG + Intergenic
968593373 4:1470817-1470839 CTGGTTACAGCATTGGGGTCAGG - Intergenic
969922784 4:10556774-10556796 CTGGTTAAAGAAAAGGAGAAGGG + Intronic
972010359 4:34172141-34172163 CAGGTTACAGGAAGGGGGTAAGG - Intergenic
972184985 4:36517813-36517835 CTGGTTAAGAAAATGGGGAAAGG - Intergenic
972703076 4:41513450-41513472 CCGGATACACAAATGGGGCAAGG - Intronic
973756181 4:54075923-54075945 CTGTTTACAGCACTGGGGTATGG - Intronic
974858230 4:67486149-67486171 ATGTTTACAGAAATGAGGAGAGG - Intronic
975451629 4:74534264-74534286 CAAGTTACAGAAAGGGGAAAGGG + Intergenic
976738955 4:88339302-88339324 CTGGTCACAGAAGTGTGCAACGG - Intergenic
978467651 4:109026539-109026561 CTGGTTATAGACTTGGGAAAAGG + Intronic
979068965 4:116176719-116176741 CTGCATATAGCAATGGGGAAAGG - Intergenic
979264088 4:118681694-118681716 GTGGTTATAGAAATGAAGAATGG + Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
979772688 4:124548401-124548423 CTGCTTCCACAAATGGTGAAAGG - Intergenic
980557391 4:134427081-134427103 CTGATTACAGAAATGGGACCAGG + Intergenic
982048029 4:151468616-151468638 ATGTCTACAGAAATGGGGCATGG - Intronic
982376403 4:154695798-154695820 CTGGTTACAGAAATGGGGAATGG - Intronic
982425368 4:155252301-155252323 CTGGTGATAGAAATGGAAAACGG + Intergenic
983184407 4:164684984-164685006 CAGGGTACAGAGATGGGTAAGGG + Intergenic
984763696 4:183383784-183383806 CAGGTGCCAGAAGTGGGGAAAGG - Intergenic
986193422 5:5517098-5517120 CTGGGCACAGAGATGAGGAAGGG - Intergenic
986462437 5:7985415-7985437 CTTGTTATAGAAATGGCAAATGG - Intergenic
986920771 5:12676636-12676658 CTGATAACAGGAAGGGGGAAGGG + Intergenic
987114705 5:14717024-14717046 CTGGGTACAGACATGGCTAATGG - Intronic
987196637 5:15533467-15533489 TTAGATACAGAAATGGGTAAAGG + Intronic
988475065 5:31577306-31577328 CAAGTTCCAGAAATGGGGAGTGG + Intergenic
990381997 5:55227584-55227606 CCGCTTACAGACAGGGGGAATGG + Intergenic
991346906 5:65678723-65678745 CTGGCAAAAGCAATGGGGAAAGG + Intronic
992736594 5:79727889-79727911 CAGGATACAGAAGTGTGGAAAGG - Intronic
993909985 5:93669639-93669661 CTGCATACTGCAATGGGGAAAGG - Intronic
994135199 5:96278446-96278468 CTGGTAAATGGAATGGGGAATGG + Intergenic
994349923 5:98733592-98733614 GTGGTTACAAAAATGAGGTAGGG - Intergenic
994748228 5:103705878-103705900 ATGATTAAAGAAATGGAGAAAGG + Intergenic
994842430 5:104942662-104942684 GAGGTTCCAGAAATGAGGAAAGG + Intergenic
994981183 5:106876306-106876328 CTGGCTACAGAACTTGGAAAAGG - Intergenic
995560014 5:113370471-113370493 CTGGGAACAGAAATGAGGATAGG - Intronic
999172698 5:149608739-149608761 CAGGTTACACAACTGGGGAAGGG + Intronic
999675715 5:154000177-154000199 GTGATACCAGAAATGGGGAAAGG + Intronic
1002213931 5:177615001-177615023 CTGATAACAGAAATGAGAAAGGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004210737 6:13639724-13639746 CAGTTTATAGAAATGGTGAATGG - Exonic
1004466792 6:15892840-15892862 CTAGGAACAGGAATGGGGAAGGG - Intergenic
1005587389 6:27290108-27290130 ATGTTTACAGAATTTGGGAAGGG - Intronic
1005913124 6:30327613-30327635 GTGGTGAGAGAAATGGGGAAAGG - Intronic
1007227920 6:40327894-40327916 ATGGGGCCAGAAATGGGGAAGGG + Intergenic
1008693091 6:54002829-54002851 CTGATTACAGATATGGAGAATGG + Intronic
1008936179 6:56995097-56995119 CTGATTACAAAAAAGGGGATGGG - Intronic
1011057163 6:83217821-83217843 CTGGGTACAGAAATAAGGACTGG + Intronic
1011104695 6:83766648-83766670 CTGACTAAAGAAATGGGGAAAGG + Intergenic
1011125660 6:84004557-84004579 CTGATTCCAGAAATGGGGCTGGG - Intergenic
1012078730 6:94728028-94728050 CTGGCTACAGAAATTTGCAAAGG - Intergenic
1013439165 6:110144723-110144745 CCTGATAAAGAAATGGGGAAAGG - Intronic
1013675100 6:112450635-112450657 CTGGAAAGAGGAATGGGGAAGGG - Intergenic
1013723326 6:113058846-113058868 CTAGTTAAACAACTGGGGAATGG + Intergenic
1015099137 6:129454164-129454186 CTGGCTATAGAAATGCGTAAAGG + Exonic
1015843260 6:137494686-137494708 TTGGTTAGAGAAATTGGGAAGGG - Intergenic
1016429843 6:143971712-143971734 CTGGTTAAAGAAATTGTCAAGGG + Intronic
1016679347 6:146810126-146810148 CTGGTTTTAAAAATGGGCAAAGG + Intronic
1017681972 6:156873184-156873206 CGGGTTGAAGAAAAGGGGAATGG + Intronic
1018567816 6:165174460-165174482 CAGGTAAGAAAAATGGGGAAAGG + Intergenic
1021562558 7:21983325-21983347 CTGCTTAGGGAAACGGGGAAGGG - Intergenic
1021910934 7:25385545-25385567 CAGTTTACAAAAATGGAGAAGGG - Intergenic
1022003956 7:26250191-26250213 TTGGTTATAGAAAAGGGAAAAGG - Intergenic
1023718493 7:43068657-43068679 CTGGGGACAGGAGTGGGGAAAGG - Intergenic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024049657 7:45610573-45610595 GTGATGACAGAAGTGGGGAAGGG + Intronic
1024359170 7:48449798-48449820 CTGGTTACAGAAATGGTATGAGG - Intronic
1024430890 7:49286525-49286547 CTGGTTACTGAGATTGAGAAGGG + Intergenic
1024629562 7:51236027-51236049 CTGCTTACGTAAAAGGGGAAGGG - Intronic
1026951213 7:74348214-74348236 CTATTTACAGAAAAGAGGAATGG + Intronic
1027168924 7:75856139-75856161 TTGGGTAAAGAAATGGGAAAAGG - Intronic
1027755089 7:82202686-82202708 CTGGCTACAGAACTTGGAAAAGG + Intronic
1028188457 7:87817686-87817708 CTGGGAACAGAGATGGGGATGGG - Intronic
1028434666 7:90788588-90788610 TTGGTTACAGTAATGGGATAGGG - Intronic
1030177062 7:106665321-106665343 CTGATACCTGAAATGGGGAAAGG - Intergenic
1031130320 7:117825912-117825934 CTCATTAGAGAAATGGGAAATGG + Intronic
1031540360 7:122987972-122987994 CTGGTAACATAAATGCAGAAAGG - Intergenic
1031645936 7:124224837-124224859 GTGGTCACAGAAATAGGAAACGG + Intergenic
1033141582 7:138831874-138831896 CTTGTTTCAGAAAAGGGGAGTGG - Intronic
1034025318 7:147697174-147697196 CTGTTAACAGAAATGAAGAATGG - Intronic
1034186388 7:149180553-149180575 CTGGTTAAAAAAATTGGAAACGG + Intronic
1034873271 7:154702513-154702535 CTGGTTGCTGATATGGAGAAAGG + Intronic
1035003794 7:155640181-155640203 CTGATTTCAGAACTGGGGCATGG - Intronic
1035657377 8:1320190-1320212 CTGTTTCCGGAAATGGGGAAGGG + Intergenic
1036070706 8:5438708-5438730 ATGGAAACAGAAGTGGGGAAAGG + Intergenic
1036924995 8:12895847-12895869 CTGGTTATAGACCTTGGGAAAGG + Intergenic
1037886266 8:22598074-22598096 CTGGTTCCAGAAAGGAGCAAAGG + Intronic
1041387820 8:57322699-57322721 CTGTTTAAAGAAATTGTGAATGG + Intergenic
1041650276 8:60295261-60295283 CTAGTTAGAGAAATGCTGAATGG - Intergenic
1041796118 8:61750650-61750672 CTGGTGTCTGAAATGGGGACTGG + Intergenic
1042915949 8:73876502-73876524 CTGGTTAGAGGAATGGAAAACGG - Intronic
1044629400 8:94263910-94263932 GTGGCTACAGATGTGGGGAAAGG + Intergenic
1044702698 8:94978667-94978689 CAGGTTACAGCAAAGTGGAATGG - Intronic
1044792867 8:95865529-95865551 CTGGTTCCAGGGCTGGGGAAAGG + Intergenic
1045588552 8:103566235-103566257 CCAGCTACAGGAATGGGGAAGGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047209561 8:122830451-122830473 TTGGTTATAGAAAAGGGAAAAGG + Intronic
1048936517 8:139362149-139362171 CTGGAGACAGCCATGGGGAAGGG + Intergenic
1050142744 9:2533307-2533329 CTGGTAACAGGAATTTGGAAGGG + Intergenic
1050407617 9:5326872-5326894 TTGATAACAGAAATGAGGAAGGG + Intergenic
1050841457 9:10154711-10154733 CTGATAAAAGCAATGGGGAAAGG - Intronic
1051244833 9:15099446-15099468 CTGGTTATCTAAATGAGGAAAGG - Intergenic
1051350475 9:16193814-16193836 CTGGTCACAGAGACAGGGAAAGG + Intergenic
1052158316 9:25223716-25223738 ATGATGACAGAAATGGGGTATGG - Intergenic
1055411338 9:76033128-76033150 TTGTCTACAGAAATGGGAAAGGG - Intronic
1055423685 9:76170916-76170938 CTCATTACAGAACTAGGGAAGGG - Intronic
1056380057 9:86049134-86049156 CTGACCAAAGAAATGGGGAAAGG - Intronic
1057072550 9:92112712-92112734 CTGCTATTAGAAATGGGGAAAGG - Intronic
1059176945 9:112175955-112175977 TTTGTTGTAGAAATGGGGAATGG + Intergenic
1062241776 9:135544809-135544831 CAGGCAACAAAAATGGGGAACGG + Intergenic
1062405336 9:136393567-136393589 CAGGTTTCAGGAATGGGAAAGGG + Intronic
1062412612 9:136432589-136432611 GTGGGAACAGAAATGGGGTAGGG + Intronic
1185549240 X:970153-970175 CTGTTGACAAAAATGAGGAATGG + Intergenic
1185719974 X:2373628-2373650 CAGGTTGGAGAAAAGGGGAAGGG + Intronic
1186505910 X:10091951-10091973 TTGTGTACAGATATGGGGAAAGG - Intronic
1186751935 X:12630373-12630395 TTATTTACAGAAATGGGGATGGG + Intronic
1187617432 X:21012589-21012611 ATGGTTACAGAAACTGGGAAGGG + Intergenic
1187918993 X:24182827-24182849 CAGGTTCCAGAGAAGGGGAAGGG + Intronic
1188330765 X:28868498-28868520 ATGGTTATAGAAATGGAGAAGGG - Intronic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1189549888 X:42082144-42082166 CGGGGTTAAGAAATGGGGAAAGG - Intergenic
1189578409 X:42380214-42380236 CTGACTACAGATATGGGGAATGG + Intergenic
1191151483 X:57224411-57224433 TTGGTTAGAGAAAAGGGAAAAGG - Intergenic
1191199726 X:57766869-57766891 CTGGATACTGAATTGAGGAATGG - Intergenic
1193468108 X:81871082-81871104 CTGGTTACATGAATGGTAAAAGG - Intergenic
1194525606 X:94973305-94973327 CTGGACACAGAAATGGGCAAAGG - Intergenic
1195012836 X:100750308-100750330 CTGATTAAAAAAATGGGTAAAGG - Intergenic
1196216475 X:113058145-113058167 CTGGGTCCAGAAATGGGAAAAGG - Intergenic
1196239089 X:113319176-113319198 GTGGTTAAAGAACTGGGGAATGG - Intergenic
1196376658 X:115040241-115040263 CGGGATACAGAAAGGGGGGAGGG + Intergenic
1196487318 X:116227745-116227767 CTGGCAAAAGCAATGGGGAAAGG + Intergenic
1197142550 X:123132482-123132504 TTGGTTATAGAAAAGGGAAAAGG - Intergenic
1198411320 X:136372353-136372375 CTGGTGAGAGAAATGGGGCTAGG - Intronic
1199972661 X:152872374-152872396 GTGGTCCCAGGAATGGGGAAAGG + Intergenic
1200756154 Y:6991840-6991862 CAACTTACAGAAATGGAGAAGGG + Intronic
1200827174 Y:7657698-7657720 CTGGACACTGAAATGGGGAGTGG - Intergenic
1200884134 Y:8252241-8252263 CTGGACACAGACATGGGGAGTGG - Intergenic