ID: 982378018

View in Genome Browser
Species Human (GRCh38)
Location 4:154715973-154715995
Sequence ATTTCCTTCTGTAAGAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982378018_982378021 25 Left 982378018 4:154715973-154715995 CCTCCACTCTTACAGAAGGAAAT 0: 1
1: 0
2: 4
3: 17
4: 208
Right 982378021 4:154716021-154716043 AACAGCTCCATTCAAAGCTTTGG 0: 1
1: 0
2: 3
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982378018 Original CRISPR ATTTCCTTCTGTAAGAGTGG AGG (reversed) Intronic
900074997 1:807178-807200 ATTTCCTTTTGTGAGATGGGTGG - Intergenic
904003638 1:27351906-27351928 ATTTCACTCTCTAACAGTGGGGG - Intronic
905768718 1:40623953-40623975 ATTACCTTCTTTTAGAGAGGTGG + Exonic
905849061 1:41259477-41259499 AATTCCTTCTGTTTGAGTGGTGG + Intergenic
906278312 1:44535093-44535115 ATTTCCTTCTGTGTGAGGAGGGG + Intronic
908269771 1:62411532-62411554 ATTTCCTTCTGCCAAAGTGCTGG + Intergenic
911143476 1:94530724-94530746 CTTTCCTAATGTAAGTGTGGTGG - Intronic
911959129 1:104277075-104277097 AGATCCTTCTGGGAGAGTGGTGG + Intergenic
912221282 1:107679642-107679664 ATTTCCTTCTGTCTCAGTGTAGG - Intronic
912318128 1:108685117-108685139 ATTTCCTTTTGCAAGTCTGGTGG - Intergenic
912638466 1:111320828-111320850 AAGTGCTTCTGTAAGACTGGGGG + Intergenic
914847974 1:151293278-151293300 ATCTCCCTCAGTAAGGGTGGAGG + Intronic
916346810 1:163801602-163801624 ATGTACGTCTGTAAGAGTAGAGG - Intergenic
917359254 1:174158936-174158958 AGTTCCTTCTGTGAGACTCGGGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919540698 1:198841495-198841517 ATCTCCTGATATAAGAGTGGGGG + Intergenic
920694758 1:208173965-208173987 ATGTGCTTCTGTGTGAGTGGGGG - Intronic
920988981 1:210917702-210917724 ATTTCCTTCTCTTAGAGGGAGGG - Intronic
921359079 1:214313808-214313830 ATTTGCTGCTGGAAGGGTGGAGG - Intronic
921381074 1:214525157-214525179 ATTGCCTTCTGTCACAGTGCTGG - Intronic
921480705 1:215661687-215661709 ATTTCTTTTTGTAAGACTGAAGG + Intronic
921895590 1:220396561-220396583 ATTTCCTACTGTAAGATTTGAGG - Intergenic
922270836 1:224032077-224032099 ATTTCCTTTTGTGAGATGGGTGG - Intergenic
922664049 1:227453926-227453948 ATTTCCCCCAGGAAGAGTGGGGG + Intergenic
923196836 1:231676414-231676436 ATTTCCATGTGTAGAAGTGGAGG - Intronic
924858087 1:247894725-247894747 ATATCCATCTGTAAGACTTGTGG + Intergenic
1063593686 10:7413328-7413350 ATTTCCTTCTGCAGGAGTCGTGG + Intergenic
1064405092 10:15054439-15054461 ACTTCCTTCTGCAAGAATTGAGG + Intronic
1064704846 10:18061009-18061031 ATTTCTGACTGTAAGAGTAGTGG + Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066316330 10:34250871-34250893 CTTTCCTCCTGGAAGTGTGGAGG - Intronic
1067471009 10:46537721-46537743 CTCCCCTTCTTTAAGAGTGGAGG + Intergenic
1067829751 10:49604463-49604485 ATTTCCTTGTGTTTGTGTGGAGG - Intergenic
1068214382 10:53964842-53964864 ATTTGCTTGTGAAAGAGTGGGGG + Intronic
1068272328 10:54744854-54744876 ATTTCCTTCAGTAAGGGAGCAGG + Intronic
1071971478 10:90912068-90912090 AAGTCCTTCTATAAGTGTGGTGG - Intergenic
1072707117 10:97688649-97688671 TTTTTCTTCTGTAAAAGTTGTGG + Intergenic
1072779838 10:98241162-98241184 ATTCCCTTCTTTTAGAGTGACGG - Intronic
1073707484 10:106001462-106001484 AAATCGTTCAGTAAGAGTGGTGG + Intergenic
1074250859 10:111745691-111745713 ATTTCCTATTGTAAGTATGGTGG + Intergenic
1074896612 10:117782651-117782673 ATTTCCACCGATAAGAGTGGTGG + Intergenic
1078099782 11:8323236-8323258 ACTTCATTCTGTAAGTGAGGGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079330343 11:19527840-19527862 ATTCCCCTCTGTAGGAGTGCTGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083668430 11:64287578-64287600 TTCTCCATCTGTAAGAGTGGAGG + Intronic
1083839086 11:65293167-65293189 ATTTCCATGTGTGAGAGGGGAGG + Intronic
1086124456 11:83335747-83335769 AATTGCTTCTGTCAGAGTGTAGG - Intergenic
1086980686 11:93195209-93195231 ATTTCCTTCTCTTCAAGTGGGGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1089578152 11:119461323-119461345 ATTCCCTTCTCTAAGGGTCGGGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092571352 12:9726015-9726037 ATTTTCATCTGTAAGAGGGCAGG - Intronic
1092669486 12:10847128-10847150 ATTTCCTTCTGTCAGCCTGCAGG - Exonic
1092973729 12:13724075-13724097 ATTTCCTTTGGCAAGAGGGGAGG - Intronic
1096642562 12:53006151-53006173 ACTTCCTGCCGGAAGAGTGGCGG - Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1099305979 12:80956339-80956361 CTTTCCTACTGAAACAGTGGTGG + Intronic
1099632943 12:85174032-85174054 ATTTGCTTCTTTTAGAGTGGGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102763765 12:115413131-115413153 CCTTCCTTCTGTAGCAGTGGGGG - Intergenic
1102925434 12:116822367-116822389 AATTCCAGCTGTAAGAGTGTTGG + Intronic
1110268217 13:73563785-73563807 ATTTCTTTTTGTTAGAGTGATGG - Intergenic
1110508811 13:76323823-76323845 ATTTCCTGTTTTATGAGTGGAGG - Intergenic
1111076958 13:83249205-83249227 CTTTCCTTCTGTTAGAGGAGAGG - Intergenic
1113571351 13:111360510-111360532 ATTTTCTTCTGAAAGTGAGGCGG + Intergenic
1114443006 14:22766130-22766152 TTTTTCTTCTGTAAGTGGGGTGG - Intergenic
1114895027 14:26977871-26977893 ATTTCTTTCTGAAACAGTGTAGG + Intergenic
1117131760 14:52694670-52694692 ATTTCCTTCTGTAAGAGATGTGG - Intronic
1117861529 14:60097155-60097177 ATTTCCTTCTGTGATGGTTGGGG - Intronic
1118399524 14:65366885-65366907 GATTCCTTCTGTAAGAAGGGAGG + Intergenic
1119277203 14:73368943-73368965 TTTTCCTTCTGTTAGTATGGAGG + Intronic
1120905937 14:89621288-89621310 ATTTCCTTTTGGCAGAGAGGAGG - Intergenic
1121052483 14:90828513-90828535 ATTTTCTTTAGTAAAAGTGGAGG + Intergenic
1121709806 14:96029310-96029332 TTTTTCATCTGTAAAAGTGGAGG - Intergenic
1121968778 14:98336925-98336947 ATTTCTCTCTTTAAGAGTTGGGG + Intergenic
1123695411 15:22875679-22875701 CCTTCCTTCTGTCAGTGTGGTGG - Intronic
1124651981 15:31480757-31480779 ATTTCCTTTTGTGAGAGAGCTGG - Exonic
1130139549 15:81212908-81212930 CTTTCCTTCTGTTAGTGTTGGGG + Intronic
1130829539 15:87585267-87585289 ATTTCCTTCTGTAGGAGAGGAGG - Intergenic
1131753242 15:95532505-95532527 ATTTTCTTCTTTAAGGGCGGCGG + Intergenic
1132841818 16:1981749-1981771 ATTTCCTCCTCTATGAGTTGGGG - Exonic
1133690132 16:8205869-8205891 ATTTTCTTCTTTAAAATTGGGGG + Intergenic
1135623665 16:23977108-23977130 ATTTCTTCCTGGAAGAGGGGAGG - Intronic
1137055024 16:35741231-35741253 AAGTCCTTTTGCAAGAGTGGGGG + Intergenic
1137762277 16:50950360-50950382 ATTTTCCTCTGTAAGATGGGAGG + Intergenic
1138835476 16:60429466-60429488 ATTTCCTTTTCTAAGTGTGATGG + Intergenic
1141350160 16:83287286-83287308 CTTTCATTCAGTAAGAGCGGGGG + Intronic
1142806912 17:2376122-2376144 AATTCTATCTGGAAGAGTGGAGG - Exonic
1148621953 17:49041516-49041538 ATTTCCCTGTTTATGAGTGGGGG + Intronic
1149158356 17:53661392-53661414 ATTGCCTTCTGAAATAGTGGTGG - Intergenic
1151581980 17:74985198-74985220 CTTTCGTTCTGAAAGAGTTGGGG - Intergenic
1153812529 18:8764629-8764651 ATTTCCTTATTTAAAAGTGGGGG - Intronic
1156727374 18:40145594-40145616 ATTTCCTTCTCTACTAATGGGGG + Intergenic
1158486910 18:57875601-57875623 ATTTCCTTCTGTTAAGTTGGCGG + Intergenic
1159622716 18:70656894-70656916 TTTCTCTTCTGTAAGAGTGACGG + Intergenic
1162667432 19:12225851-12225873 ATTTCCTCCGGTGAGAGTCGGGG + Intronic
1163599591 19:18240873-18240895 ATTTCCTTGCCTATGAGTGGAGG + Intronic
1165599518 19:37041843-37041865 ATTTCTTTCTGTAAAAATGAAGG + Intronic
926555549 2:14353654-14353676 AATTCCTCCTGTAAGAATGTGGG + Intergenic
928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG + Intronic
930842765 2:55865618-55865640 AACTCCTTCTGTGAGAGTAGGGG - Intergenic
931880197 2:66560690-66560712 TTTTCCTTCTCTAACAGTGTTGG - Intronic
933650830 2:84848943-84848965 ATTTCCTTCAGAAACAGTGAAGG - Intronic
937940006 2:127277864-127277886 ACTTCCTACTGTAGGAGTTGAGG - Intronic
940273806 2:151918557-151918579 ATGTGCTTGTGTAACAGTGGAGG - Intronic
945026422 2:205624064-205624086 AGTTCCGTCTGTCAGAGTGCTGG - Intergenic
945672802 2:212822391-212822413 ATTTCCTTCTGTATTAGTCAAGG + Intergenic
947514049 2:230785621-230785643 AATTCCTTCTGAAAGAGAAGGGG + Intronic
948354378 2:237366194-237366216 ATTTCTCTCTGTGAGAGGGGTGG - Intronic
948620462 2:239231445-239231467 CTTTCCTTCTGTAGGAGCAGTGG + Intronic
949082726 2:242117606-242117628 ATTTCCTTTTGTGAGATGGGTGG + Intergenic
1168810554 20:701819-701841 ACCTCCGTCTGGAAGAGTGGGGG - Intergenic
1169593646 20:7173697-7173719 AATTCATTCTGAAAGAGTGAAGG - Intergenic
1172322718 20:34009144-34009166 TTTTCCATTTATAAGAGTGGGGG + Intronic
1172983154 20:38960352-38960374 AGTTCCCTGTGTAATAGTGGCGG + Intergenic
1172983166 20:38960507-38960529 AGTTCCCTGTGTAATAGTGGCGG + Intergenic
1172983178 20:38960645-38960667 AGTTCCCTGTGTAATAGTGGCGG + Intergenic
1172983191 20:38960783-38960805 AGTTCCCTGTGTAATAGTGGCGG + Intergenic
1177092522 21:16786881-16786903 ATTCCCTTCTGTAACACAGGGGG - Intergenic
1179044091 21:37829682-37829704 ATTACTTTCTGTAAGAGGAGTGG + Intronic
1180074392 21:45455381-45455403 CTTTCCTTCTGCAAGAGTGGGGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952682901 3:36116481-36116503 ATTTCCTTTTGTTGGGGTGGGGG - Intergenic
953774594 3:45804432-45804454 TTTTCCTTCTGTTATAATGGAGG + Intergenic
954613411 3:51957886-51957908 AGTTCTTTCTCTCAGAGTGGGGG - Exonic
956813185 3:72884881-72884903 AATTCTTTCTGTAGGATTGGGGG + Intergenic
957172580 3:76757674-76757696 ATTTGTTTCTGAAACAGTGGGGG + Intronic
958446042 3:94216347-94216369 ATTTTCTTCTCAAAGAGTTGGGG - Intergenic
960654578 3:119989118-119989140 ATTTCCTTCTGTGATGGTCGGGG - Intronic
961375219 3:126460723-126460745 ATTTCTTTCAGTCAGAGAGGAGG - Intronic
964147602 3:153484168-153484190 AATTCCTCCTGTAAGTGTGTGGG + Intergenic
965769638 3:172168245-172168267 ATTTGCTCCTGTAAGCCTGGTGG + Intronic
965815037 3:172627653-172627675 ACTTCATTCTGTGAGACTGGTGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966718026 3:183033288-183033310 ATTTTCTACTGGAAAAGTGGTGG + Intronic
966958680 3:184910933-184910955 ATTTTTTACTGTAAGGGTGGGGG + Intronic
967407224 3:189130625-189130647 ATTCCCTTCTGTGAGTGTGAGGG + Intronic
969060581 4:4431146-4431168 ATTTCCTTTATGAAGAGTGGTGG + Intronic
969134550 4:5019688-5019710 ATTTCTTGCTGAAAGTGTGGGGG - Intergenic
969896130 4:10306658-10306680 ATGTCATTCTGTAAGATAGGTGG + Intergenic
973344652 4:49041641-49041663 ATTTCTTTATGTAAAAGTGTGGG + Intronic
973565868 4:52186927-52186949 ATTTCCCTCTGTATGAGTCCAGG + Intergenic
975454134 4:74569553-74569575 ATTCCCCTCTGTAAGTGTGAGGG - Intergenic
975525561 4:75345482-75345504 ATTTCCTTCAGCAAGAGAGTTGG - Intergenic
976339986 4:83936069-83936091 ATTGCCTTCTGAAAGTGTGTTGG + Intergenic
977277414 4:94994837-94994859 TGTTCCTTCTGTTAGAATGGTGG - Intronic
979704153 4:123700964-123700986 ATTTACTTCCGTATGAGAGGGGG - Intergenic
980070494 4:128238319-128238341 ATTTTCTTCTGTAATAAAGGAGG - Intergenic
982378018 4:154715973-154715995 ATTTCCTTCTGTAAGAGTGGAGG - Intronic
982406419 4:155025072-155025094 TCTTCCTTCTGTAAGAGCTGAGG - Intergenic
982966102 4:161910170-161910192 TTCTCCTTCTGTAACACTGGTGG + Intronic
983514598 4:168642732-168642754 ATTTGCTTCTGAAAAAGTGCAGG - Intronic
986239299 5:5943157-5943179 ATTTTCTTCTGTCATAGTGATGG - Intergenic
987328766 5:16836333-16836355 ATTTTTGTCTGTAACAGTGGAGG - Intronic
987594067 5:19973342-19973364 ATTCCATTTTGTAAGAGTGGTGG + Intronic
987744454 5:21951843-21951865 ATTTCCTTAAGCAAGAGTGAGGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989338195 5:40343704-40343726 TTTTACTTCTGTAAGATTGGTGG - Intergenic
989461162 5:41699953-41699975 GTTACTTTCTGGAAGAGTGGTGG + Intergenic
989790886 5:45400223-45400245 ATTTCTTTTTGTATGAATGGAGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991473033 5:66989618-66989640 ATTTCTTTCTGTAAGGGAGCTGG - Intronic
991764664 5:69961967-69961989 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991782660 5:70156186-70156208 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
991843896 5:70837038-70837060 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991875103 5:71156500-71156522 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
994888981 5:105604987-105605009 ATTTGCTTCTATATGTGTGGGGG + Intergenic
998682618 5:144487200-144487222 ATGTCATTCTGGAACAGTGGAGG - Intergenic
999467755 5:151823262-151823284 ATTTCCTTCTGTGAGTCTCGGGG + Intronic
1002027900 5:176407894-176407916 ATTTTCTTATGTAAGAGGGATGG - Intronic
1003222500 6:4173494-4173516 ATTTCCTTCTCTTGAAGTGGGGG + Intergenic
1005162842 6:22884348-22884370 ATTTACTTATGGAAGAGTGAAGG - Intergenic
1007370728 6:41425504-41425526 ATCTCCTTCTGTTAGATTGGAGG - Intergenic
1007380501 6:41487513-41487535 ATTTCCTCTGGTAAAAGTGGGGG + Intergenic
1010769160 6:79808739-79808761 ATTTCCTTCTGTAAAGATGGAGG + Intergenic
1011989690 6:93498871-93498893 AATTCCCTCTGTAAGAATGTAGG + Intergenic
1013587002 6:111588312-111588334 ATTTCCTTCTGTTAGGGGGTTGG - Intronic
1014314514 6:119846633-119846655 ATTTCATTCTGTAAGCTTTGTGG + Intergenic
1014380694 6:120737467-120737489 ATTTCTTTCTGTTAGAGATGAGG - Intergenic
1015766950 6:136728898-136728920 CTTTCCTTTTGTAAGTGTAGTGG - Intronic
1016071781 6:139747805-139747827 ATTTGAATCTGTAAGGGTGGCGG + Intergenic
1016235138 6:141855281-141855303 ATTTCCTTCTGTATTAGTCAGGG + Intergenic
1017781379 6:157717984-157718006 ATTTCCCTCTGTATGTCTGGGGG + Intronic
1018384081 6:163287324-163287346 TTTCCCTTCTGTAAGAGCAGTGG - Intronic
1018441003 6:163813366-163813388 ATTGTCTTCTGTAAGCATGGTGG + Intergenic
1020910529 7:14124915-14124937 ATTTCCTTCTGTAAAAAAGGAGG - Intergenic
1021571877 7:22074424-22074446 ATACCCATCTGTAAAAGTGGGGG - Intergenic
1022579851 7:31540312-31540334 ATTTCCTCCTGTAATACTGGTGG + Intronic
1026347984 7:69491485-69491507 AGTTCCTTGTGTTAAAGTGGAGG - Intergenic
1027234379 7:76289335-76289357 ATTTCTCTCTCTTAGAGTGGTGG + Intergenic
1029127135 7:98302195-98302217 ATTCCCTGCAGTAAGAATGGCGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1032271809 7:130415477-130415499 CTTTCCCTCTGTAGGAGTGGAGG - Intronic
1033143023 7:138844543-138844565 GTTACCTTCTGTAAGGTTGGGGG - Intronic
1033290057 7:140076046-140076068 GGTCCCTTCTGTCAGAGTGGAGG - Intergenic
1033910451 7:146257576-146257598 ATTTCTTTCTGTGAGAATGAAGG + Intronic
1035540650 8:434309-434331 ATTTCCTGTTGTAAGATGGGTGG + Intronic
1035966444 8:4197430-4197452 ATTTCCTTCTGTAATGTAGGTGG + Intronic
1035986191 8:4434465-4434487 CTTTCCTTCTGTTAGAGTGTGGG - Intronic
1042078027 8:65017262-65017284 ATTTACTTCTGTATCAGTCGTGG - Intergenic
1042938717 8:74086505-74086527 TTTTCCTTCTGTAAAAGTCAGGG + Intergenic
1046743340 8:117851397-117851419 GTTTCATTCTGTAAGAGGAGTGG + Intronic
1046796051 8:118373357-118373379 ACTTCCTTCTTTAAGAAAGGTGG + Intronic
1048785947 8:138050437-138050459 AAGTACTTTTGTAAGAGTGGTGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051231104 9:14956671-14956693 AACTCCTCCTCTAAGAGTGGTGG - Intergenic
1052463066 9:28792266-28792288 ATCTTTTTCTTTAAGAGTGGAGG - Intergenic
1054817846 9:69492652-69492674 ATTTCCAAATGTAAGAGTTGAGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1059997605 9:119927624-119927646 AATTCCTTCTGTACCACTGGTGG - Intergenic
1060715230 9:125920438-125920460 ATTTCCTTTTGGTAGGGTGGTGG - Intronic
1061062250 9:128256358-128256380 ATTTGCTACTGTAAGAGTAAAGG + Exonic
1061076549 9:128344933-128344955 ATTTCCTTCTGTGTAAGGGGAGG + Intronic
1062072423 9:134564005-134564027 ATCTCCTTCTGTATGAGTTGGGG - Intergenic
1188090805 X:25963498-25963520 GTTTCCTTCTGTAAGATTTATGG - Intergenic
1188914641 X:35895433-35895455 ATATGCTTCTGTAAAAGTTGAGG + Intergenic
1189398457 X:40644361-40644383 ATTTCCTTCTGCTACAGAGGAGG - Intronic
1189620424 X:42831218-42831240 GTTTCCTTGTGTAATATTGGAGG + Intergenic
1189818392 X:44846511-44846533 TTTTCCATCTGTAAAAGTAGTGG - Intergenic
1192026221 X:67455979-67456001 ATTTCCTTATTTAATAGTTGTGG - Intergenic
1193349245 X:80439872-80439894 ATTTTCTTATGTAACAGTAGAGG + Intronic
1194068469 X:89290612-89290634 ATTTCCCTCTGTAAGTTGGGTGG - Intergenic
1194143535 X:90235049-90235071 ATTTCCTCCTGTAATGGTGAGGG - Intergenic
1194156966 X:90402876-90402898 ATTTTCTTCTGTAAGCTTTGGGG + Intergenic
1194376434 X:93139179-93139201 TCTTCTTTCTGTAAGATTGGTGG + Intergenic
1196895288 X:120330068-120330090 ATTTTTTTCTTTAAGAGTAGTGG + Intergenic
1199702929 X:150398477-150398499 CTTTCCTGCTGTATCAGTGGGGG + Intronic
1200489288 Y:3804370-3804392 ATTTCCTCCTGTAATGGTGAGGG - Intergenic