ID: 982380076

View in Genome Browser
Species Human (GRCh38)
Location 4:154740636-154740658
Sequence CAGTGTCCCCGCAGGGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 198}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982380076_982380087 18 Left 982380076 4:154740636-154740658 CCGACCACCCTGCGGGGACACTG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 982380087 4:154740677-154740699 CTGCAGGCGGGTAGGGGAAGCGG 0: 1
1: 1
2: 4
3: 40
4: 587
982380076_982380082 6 Left 982380076 4:154740636-154740658 CCGACCACCCTGCGGGGACACTG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 982380082 4:154740665-154740687 TCATTCCTTCTTCTGCAGGCGGG 0: 1
1: 0
2: 10
3: 34
4: 249
982380076_982380089 30 Left 982380076 4:154740636-154740658 CCGACCACCCTGCGGGGACACTG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 982380089 4:154740689-154740711 AGGGGAAGCGGTGGCCAAAGTGG 0: 1
1: 0
2: 2
3: 24
4: 302
982380076_982380081 5 Left 982380076 4:154740636-154740658 CCGACCACCCTGCGGGGACACTG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 982380081 4:154740664-154740686 GTCATTCCTTCTTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 26
4: 247
982380076_982380083 10 Left 982380076 4:154740636-154740658 CCGACCACCCTGCGGGGACACTG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 982380083 4:154740669-154740691 TCCTTCTTCTGCAGGCGGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 115
982380076_982380086 12 Left 982380076 4:154740636-154740658 CCGACCACCCTGCGGGGACACTG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 982380086 4:154740671-154740693 CTTCTTCTGCAGGCGGGTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 134
982380076_982380088 21 Left 982380076 4:154740636-154740658 CCGACCACCCTGCGGGGACACTG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 982380088 4:154740680-154740702 CAGGCGGGTAGGGGAAGCGGTGG 0: 1
1: 0
2: 2
3: 25
4: 360
982380076_982380085 11 Left 982380076 4:154740636-154740658 CCGACCACCCTGCGGGGACACTG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 982380085 4:154740670-154740692 CCTTCTTCTGCAGGCGGGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 111
982380076_982380080 2 Left 982380076 4:154740636-154740658 CCGACCACCCTGCGGGGACACTG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 982380080 4:154740661-154740683 GCTGTCATTCCTTCTTCTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982380076 Original CRISPR CAGTGTCCCCGCAGGGTGGT CGG (reversed) Intronic
900166307 1:1245512-1245534 CAGAGACCCTGCAGGGTGGCGGG - Intronic
900334324 1:2154075-2154097 CTGTGGCCCCGCAGGGACGTCGG - Intronic
900426621 1:2583230-2583252 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
900546946 1:3234599-3234621 CAGGGCCCCCGCAGGCTGGATGG + Intronic
900664966 1:3809038-3809060 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
901291395 1:8126928-8126950 CTGTGTCCCCACATGGTGGAAGG - Intergenic
902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG + Intergenic
902890091 1:19436904-19436926 CTGTGTACCCGCAGTGTGGCTGG + Intronic
902899753 1:19506778-19506800 CTGTGTCCCCACATGGTGGAAGG + Intergenic
903446578 1:23426099-23426121 CAGTATCCCCTCAGTGGGGTTGG + Intergenic
904522334 1:31105339-31105361 AAGTGTCCGGGCATGGTGGTGGG - Intergenic
905717217 1:40161914-40161936 CTGTGTCCTGGCCGGGTGGTTGG + Intronic
906689607 1:47783944-47783966 CAGTTTCCCCACATGGTGTTGGG + Intronic
908177426 1:61569527-61569549 CAGCATCCCCGCAGGATGGAGGG - Intergenic
908809608 1:67966553-67966575 CAGTGTCCTCACAGGGTGGAAGG - Intergenic
909651339 1:77979306-77979328 AATTGTTCCTGCAGGGTGGTGGG + Intronic
912490623 1:110060833-110060855 CTGTGGCCCCCCAGGGTGGGGGG + Exonic
915367685 1:155324727-155324749 CTGTGTCCCCGAAGGGTCTTGGG - Intronic
916567903 1:165997578-165997600 CAGTGACCCAGGAGGCTGGTTGG - Intergenic
916671406 1:167024640-167024662 CTGTGTCCCCACATGGTGGAAGG - Intergenic
918144427 1:181743090-181743112 CACCGTCCCTGCAGGGAGGTGGG + Intronic
919768261 1:201141056-201141078 CAGTGCCCACTCAGGGTGGTTGG - Intronic
1063023535 10:2154934-2154956 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1064218102 10:13417312-13417334 CCGTGTCCTCACAGGGTGGAAGG - Intergenic
1064991987 10:21264290-21264312 CACTGTCCCAGCACCGTGGTAGG - Intergenic
1070804190 10:79261166-79261188 CTGTGGCCCCGCCGGGTGGTCGG + Intronic
1070967852 10:80540463-80540485 CCGTGTCCCTGCGGGGTGGCAGG + Intronic
1071335881 10:84600230-84600252 CAGGTTCCACGCAGGGTGGGAGG - Intergenic
1071787459 10:88917925-88917947 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1074129172 10:110558025-110558047 CAGTGGCCCCCCAGAGTGCTGGG + Intergenic
1074814221 10:117132820-117132842 CAGGGACGCCGCTGGGTGGTCGG - Intronic
1076510879 10:131012848-131012870 CAGTGAGCCCGCAGAGTTGTGGG - Intergenic
1076726035 10:132413762-132413784 CAGAGTCCCCCCAGGGAGTTGGG - Intronic
1076859088 10:133131758-133131780 CAGGAGCCCCTCAGGGTGGTTGG - Intergenic
1077164107 11:1127394-1127416 CAGCGTCCTCCCCGGGTGGTGGG - Intergenic
1077621207 11:3725967-3725989 CAGTGGCCAGGCATGGTGGTGGG - Intronic
1078056063 11:8009897-8009919 CTGTGCCCCCTCAGGGTGGAAGG + Intergenic
1078909978 11:15722052-15722074 CAGTGTCCTCACAGGATGGAAGG + Intergenic
1081348302 11:42017669-42017691 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1082087690 11:48063555-48063577 CAGTGTCCCAACAGGCTGCTGGG + Intronic
1082114312 11:48311586-48311608 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1083904783 11:65662634-65662656 CAGTTTCCCCTCTGGGTGGAGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085393225 11:76193247-76193269 CAGTGTCCCTGCAAGGTGCAGGG - Intronic
1088252922 11:107877225-107877247 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1088992329 11:114964407-114964429 CTTTGTCCCAGCAGAGTGGTTGG + Intergenic
1089253072 11:117179063-117179085 CAGGGTCCCCGCAGGGGAGGGGG - Exonic
1089310659 11:117556202-117556224 CAGTGACCCTGCAGGGAGATGGG + Intronic
1089564869 11:119365373-119365395 CTGTGTGCCAGCAGTGTGGTGGG + Intronic
1101475550 12:105043750-105043772 CAGTGTCCCTGCAGGATTATAGG + Intronic
1101743742 12:107522089-107522111 CTGTGTTCTCGCAGGGTGGTGGG + Intronic
1101788116 12:107903852-107903874 CAGTTTCCCAGCAGGCTGGGCGG - Intergenic
1102704746 12:114871210-114871232 CACTGTCCCTGCTGGGTGGCAGG - Intergenic
1103905909 12:124327099-124327121 CCGGGTCCCCGCAGGGAGGAAGG + Intronic
1104078146 12:125408437-125408459 CTGTGTCCTCGCATGGTGGAAGG - Intronic
1104207916 12:126657827-126657849 CTGTGTCCTCGCATGGTGGAAGG - Intergenic
1105418159 13:20231312-20231334 CAGTGTCCCCGCCTGGTTGCAGG + Intronic
1109497104 13:63187357-63187379 CAGTTTCCCAGGAAGGTGGTGGG + Intergenic
1113793231 13:113041684-113041706 CAGTGTTCCCGAAATGTGGTAGG + Intronic
1113878082 13:113607133-113607155 CAGCCTCCCTGCAGGGTGTTTGG - Intronic
1121303550 14:92890520-92890542 CAGTGTCCTCACATGGTGGAAGG - Intergenic
1121862247 14:97329447-97329469 CTGTGTCCTCACAGGGTGGAGGG + Intergenic
1122053462 14:99075843-99075865 GAGTGTCCCCTGAAGGTGGTGGG - Intergenic
1122120808 14:99552495-99552517 CAGTGTCCCCTCAGTCCGGTGGG + Intronic
1122603303 14:102931790-102931812 AAGTGCCCCCGCTGGGTGCTGGG + Intronic
1123117296 14:105900489-105900511 CAGTGTCCCCACTGGATGGGAGG - Intergenic
1123119386 14:105909758-105909780 CAGTGTCCCCACTGGATGGGAGG - Intergenic
1123147067 14:106142230-106142252 CTGTCTCCCTGCAGGGAGGTTGG + Intergenic
1124719208 15:32097453-32097475 CTGTGTCCTCGCATGGTGGAAGG - Intronic
1125542278 15:40476442-40476464 CAGTGTCCACCCAGGGGGGTGGG - Intergenic
1127770124 15:62224255-62224277 CAGGGGCCCCGCTGGGCGGTGGG + Intergenic
1128629832 15:69253324-69253346 CAGTGTTCCCACAGGGTGAGTGG - Intronic
1129036776 15:72655020-72655042 CAAAGTCACCGCAGGGTGATTGG - Intronic
1129213111 15:74082205-74082227 CAAAGTCACCGCAGGGTGATTGG + Intronic
1129301776 15:74629661-74629683 CAGTGTGACGGCAGGGTCGTGGG - Intronic
1129397289 15:75258881-75258903 CAAAGTCACCGCAGGGTGATTGG - Intronic
1129400900 15:75283158-75283180 CAAAGTCACCGCAGGGTGATTGG - Intronic
1129730247 15:77926521-77926543 CAAAGTCACCGCAGGGTGATTGG + Intergenic
1130220909 15:82018617-82018639 CAGTGACCCCGGAGGGTAATGGG - Intergenic
1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG + Intronic
1132119408 15:99163766-99163788 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1132696399 16:1204064-1204086 CAGTGTGCCCGCTGGGGGGCTGG - Exonic
1138954382 16:61953093-61953115 CTGTGTCCCCACATGGTGGAAGG - Intronic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143250915 17:5522396-5522418 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1144945346 17:18966880-18966902 CAGGGTGCCGGCAGGGTGGAGGG + Intronic
1147420763 17:40321183-40321205 TGGTGTCCCCGCAGGGTGGGCGG + Intronic
1147864670 17:43544793-43544815 AAGTGTCCACGCTGGGTGCTGGG + Intronic
1150304376 17:64071813-64071835 CAGTGTCCCCCCAGTGTGCAAGG - Intronic
1151767335 17:76139239-76139261 AATTGTCCCCCCAGGGAGGTTGG + Intronic
1151928226 17:77214089-77214111 CAATGTCGCCGCTGGGTGGGCGG - Intronic
1152094106 17:78263242-78263264 CAGTGCGGCCGCAGGCTGGTAGG - Intergenic
1152504852 17:80742077-80742099 CAGTGTCAACGCAGGGTGGTGGG + Intronic
1153568776 18:6447253-6447275 CAGTGTCCCCTGTGGGTGGCTGG + Intergenic
1156354176 18:36327497-36327519 CAGTGACTCTGCAAGGTGGTTGG + Intronic
1157311303 18:46555461-46555483 CAGTGTTCCCTCGGGCTGGTAGG + Intronic
1160049796 18:75422103-75422125 CAGTGGCCCTGCTGGGTGGGCGG - Intronic
1160730776 19:640790-640812 CGGTGTCCCCGCCGGGCGGGGGG + Intronic
1160899673 19:1421452-1421474 TCGTGTCCCAGTAGGGTGGTTGG + Intronic
1161373756 19:3928369-3928391 CAGTGTCCCCACTGGGTGGATGG - Intergenic
1162025640 19:7892540-7892562 CAGTGTCCCTGCAGGATCCTTGG + Intronic
1162408367 19:10489584-10489606 CAGTTTCACCCCAGGATGGTAGG + Intronic
1163156307 19:15441499-15441521 CAATGACCCCGCAGGGTGTAGGG + Intronic
1163338242 19:16687649-16687671 CTGTGTCCTCGCATGGTGGAAGG + Intronic
1165022530 19:32936104-32936126 CCGTGTCCCCGCAGGCTTATGGG + Intronic
1165781110 19:38434744-38434766 CAGTGGCTCCGCAGGGTGTGGGG + Intronic
1166851562 19:45763877-45763899 CTGTGTCCCCGCAGGGGCCTGGG - Intronic
1167674384 19:50875413-50875435 CTGTGTCTCCCCAGGGTGGAGGG - Intronic
1167800147 19:51735382-51735404 CTGTGTCCTCACATGGTGGTGGG + Intergenic
1168476259 19:56677569-56677591 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
926018491 2:9474679-9474701 CAGCGACCCCGCAGGGAGGCCGG - Intronic
927347865 2:22069015-22069037 CAGTGTCCTTGCAGGGCAGTGGG - Intergenic
932261681 2:70332493-70332515 AAGTATCCCAGCATGGTGGTGGG - Intergenic
934992917 2:98933965-98933987 CAGTGTCCTCACATGGTGGAAGG + Intronic
935124059 2:100207474-100207496 CTATGTCCCTGCAGGCTGGTAGG + Intergenic
937023761 2:118680863-118680885 CAGTGTCCTGGCAGGGTGGTGGG - Intergenic
937062331 2:118989913-118989935 CAGTGACCCAGCAGGATGCTGGG + Intronic
937986796 2:127641625-127641647 GAGTGCCCCCACCGGGTGGTGGG - Intronic
938099993 2:128492193-128492215 CTGGGTCCCTGCAGGATGGTGGG - Intergenic
938240273 2:129737945-129737967 CACTGTCCCCGCAGGAGGGCAGG - Intergenic
939826094 2:147017222-147017244 CTGTGTCCCCACATGGTGGAAGG + Intergenic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
948799569 2:240425855-240425877 CAGTGTTCCTGCTGGGTGGGAGG + Intergenic
1169907155 20:10615837-10615859 CAGTGTCCCCACAAAGTGGAAGG + Intronic
1170382918 20:15781571-15781593 CTGTGTCCCCACATGGTGGAAGG + Intronic
1170586195 20:17735833-17735855 CATTTTCCCCAGAGGGTGGTGGG - Exonic
1170975583 20:21160835-21160857 CTGTGTGCTCGCAGGGTGGAAGG - Intronic
1171199344 20:23228460-23228482 CAGTGTCCTCACATGGTGTTGGG - Intergenic
1171439397 20:25148387-25148409 AAGCGTCCCCGCAGCCTGGTCGG - Intergenic
1172636800 20:36415602-36415624 CAGTGTCCTCAAAGGGTTGTTGG - Intronic
1172890368 20:38260119-38260141 CATTGTCCCGGCAGGGAGTTTGG - Intronic
1173428131 20:42960349-42960371 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1174447112 20:50597751-50597773 CAGTGTCCCAGTCGGGTGGGTGG - Intronic
1175133240 20:56805210-56805232 CAGTGTTCCCCAAGGTTGGTGGG + Intergenic
1177338446 21:19763795-19763817 CAATGTCCCCACATGGTGGAAGG - Intergenic
1178583212 21:33853213-33853235 CTGTCTCCAGGCAGGGTGGTAGG + Intronic
1179533933 21:42039318-42039340 CTGTGTCCCCACATGGTGGAGGG + Intergenic
1180009609 21:45040692-45040714 CAGGGTCCCTTCAAGGTGGTGGG + Intergenic
1180847513 22:18992038-18992060 CAGAGAACCCGCAGGGTTGTTGG + Intergenic
1181484899 22:23224453-23224475 CATTCTCTCAGCAGGGTGGTGGG + Intronic
1183007562 22:34916188-34916210 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
1183516944 22:38272440-38272462 CAGTGACCTGGGAGGGTGGTCGG - Intronic
1184732898 22:46380720-46380742 GAGTGCCCCCGCAGGGTCGGGGG - Intronic
1185281741 22:49972606-49972628 CTGTGTCCCCGCGAGGTGCTGGG + Intergenic
954394565 3:50286662-50286684 CAGTGTGCCTGCTGGGTGGATGG - Exonic
962814902 3:138988832-138988854 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
967932909 3:194703275-194703297 CAGTGTCCACTCAGATTGGTGGG - Intergenic
968235635 3:197028960-197028982 CAGTTTCCCGCCTGGGTGGTGGG - Intronic
968298172 3:197593231-197593253 CTGTGTCTCCGCACGGAGGTGGG + Intergenic
968903933 4:3443263-3443285 CAGAGACCCTCCAGGGTGGTGGG + Intronic
968914906 4:3493178-3493200 TAGTGGGCCCGCAGGGAGGTGGG - Exonic
969128456 4:4972208-4972230 CTGTGTCCACACAGGGTGGAAGG - Intergenic
969270198 4:6094482-6094504 CAGGGGCCCCGGAGGTTGGTAGG - Intronic
969299007 4:6286359-6286381 CTGTGTCCTCACAGGGTGGAAGG - Intronic
970551205 4:17182914-17182936 CAGTGTCCCCGAAGGCATGTTGG - Intergenic
979778508 4:124620197-124620219 CAATTTCCCCTCAGGGTGTTTGG + Intergenic
982380076 4:154740636-154740658 CAGTGTCCCCGCAGGGTGGTCGG - Intronic
982727995 4:158925932-158925954 CTGTGTCCTCACAGGGTGGAAGG + Intronic
985724353 5:1508011-1508033 CTGTGTCCTCGCAAGGTGGAGGG - Intronic
985791473 5:1930779-1930801 CAGTGGCCCCGGAGCGTGGAGGG + Intergenic
986029418 5:3881243-3881265 CTCTGTCCCTGCAGGGTAGTGGG + Intergenic
992962758 5:81972198-81972220 CAGTGGCCTCGCAGGGCGCTGGG + Exonic
994913612 5:105944717-105944739 CTGTGTCCCCACAGGATGGAAGG - Intergenic
995208219 5:109506608-109506630 CAATGTCTATGCAGGGTGGTGGG - Intergenic
996769469 5:127071039-127071061 TAGTGTCCCTGAAGGGAGGTTGG - Intronic
997662711 5:135601668-135601690 CACTGTCCCTGCAGTCTGGTAGG - Intergenic
1000645835 5:163759270-163759292 CACTGTCCCAGCAGGGTGGGGGG + Intergenic
1001295770 5:170497827-170497849 CAGTGTCCCAGCTGCGTGGGTGG + Intronic
1003289715 6:4769664-4769686 CAGTGTGCCCACGGGGTGCTGGG + Intronic
1003294334 6:4810750-4810772 CAGTGTCCTCACATGGTGGAAGG + Intronic
1003893807 6:10587819-10587841 CAGTGACCCAGCATGGTTGTGGG + Intronic
1005122323 6:22403296-22403318 CAGTGTCCTTGGAGGGTGGAAGG - Intergenic
1005910224 6:30303020-30303042 CACTGTCCCCACAGAGTGGCTGG + Intergenic
1006047344 6:31308693-31308715 CTGTGTCCCCGCGGGGAGGCAGG - Intronic
1006429815 6:33988640-33988662 CAGAGTGCCATCAGGGTGGTGGG + Intergenic
1012546083 6:100420951-100420973 CTGTGTCTCTGCAGGGTGGGAGG + Exonic
1015366526 6:132402142-132402164 CTGCGGCCCCGCAGGGTGGGAGG - Intergenic
1016526745 6:145010202-145010224 CAGTGTCCCTACATGGTGGAAGG - Intergenic
1017206340 6:151807863-151807885 CCGTGTCCCCGCAGGGCAGAAGG - Exonic
1018949688 6:168370979-168371001 CTTTGTCCCCTCAGGTTGGTGGG + Intergenic
1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG + Intergenic
1021783711 7:24132535-24132557 CACTGACCCCACAGGGTGGCTGG + Intergenic
1022835441 7:34109248-34109270 CAGTGTCTCAGCTGGGAGGTAGG + Intronic
1026915102 7:74115472-74115494 CAGTGCCCCCGCAGGTGGGAGGG + Intronic
1026939868 7:74281367-74281389 CAGTGACCCTGCAGGGAGGGTGG + Intergenic
1030427194 7:109393488-109393510 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1034362254 7:150510311-150510333 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1034773376 7:153801572-153801594 CAGTGTCCCAGCAGAGCGGCTGG - Intergenic
1037779404 8:21857439-21857461 AAGTGTCCAGGCATGGTGGTGGG + Intergenic
1042570715 8:70161811-70161833 CTGTGTCCCAGCAGTGCGGTTGG - Intronic
1048468533 8:134687050-134687072 TTGTGTCCCTGCAGGGTGGAGGG - Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049201115 8:141341128-141341150 CATTGTCCCTGCAGGGTGCAGGG + Intergenic
1049398908 8:142416107-142416129 CAGTGTCTGCTCCGGGTGGTGGG - Intergenic
1050060250 9:1701292-1701314 CAGTGTCCTCGCATGGTGGAAGG - Intergenic
1051480086 9:17550230-17550252 CAATGTCCTCACAGGGTGGAAGG + Intergenic
1051707514 9:19895997-19896019 CAGTGTGACGGCAGGGTCGTGGG + Intergenic
1057075126 9:92134614-92134636 CAGAATCCCAGCAGGGTGGCAGG + Intergenic
1058636301 9:107041688-107041710 CTGTGTCCTCACATGGTGGTGGG + Intergenic
1060036390 9:120259641-120259663 CAGGTTCCCAGCAGGGTGCTGGG + Intergenic
1060066879 9:120510053-120510075 CAGTGTCTCTACAGGCTGGTTGG - Intronic
1060881993 9:127123807-127123829 CTGTATCCCCGCAGGGTGCCCGG - Intronic
1062432048 9:136530583-136530605 AAGTGCCCCCGCAGGCTGTTTGG + Intronic
1062584261 9:137241850-137241872 CGGGGTCCCCGGAGGGCGGTCGG - Intronic
1185845321 X:3432496-3432518 CTGTGTCCCCACATGGTGGAAGG + Intergenic
1185967933 X:4628629-4628651 CTGTGTCCTCGCATGGTGGAAGG - Intergenic
1189797349 X:44657738-44657760 CATTATCCCAGCATGGTGGTGGG + Intergenic
1192880030 X:75274003-75274025 CAGTGGCGCCGCAGAGTGGCGGG + Intergenic
1198807116 X:140503827-140503849 CCGCGTCCCCGCCGGGTGGCAGG + Exonic
1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG + Intergenic