ID: 982386114

View in Genome Browser
Species Human (GRCh38)
Location 4:154804126-154804148
Sequence TTCTGTAAGCTTTACAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1181
Summary {0: 1, 1: 1, 2: 51, 3: 402, 4: 726}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982386114_982386117 25 Left 982386114 4:154804126-154804148 CCATGCTTGTAAAGCTTACAGAA 0: 1
1: 1
2: 51
3: 402
4: 726
Right 982386117 4:154804174-154804196 TGTATAAATTACCCAGTCTCAGG 0: 150
1: 6905
2: 13548
3: 14420
4: 11381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982386114 Original CRISPR TTCTGTAAGCTTTACAAGCA TGG (reversed) Intronic
900499824 1:2998543-2998565 TTCTGCAAGCTGTACAGGAAGGG + Intergenic
901335105 1:8442534-8442556 TTCTGCAGGCTGTACAAGCACGG - Intronic
902111119 1:14079094-14079116 TTCTGCGGGCTGTACAAGCATGG + Intergenic
902322551 1:15678614-15678636 TTCTGCAGGCTGCACAAGCATGG + Intergenic
902745004 1:18467926-18467948 TTCTGCAGGGTGTACAAGCATGG + Intergenic
902789337 1:18755659-18755681 TTCTGCAAGCTATACAAGCATGG - Intergenic
904371505 1:30050363-30050385 TTCTGCAGGCTGTATAAGCATGG + Intergenic
904778559 1:32927059-32927081 TTCTGTAGGCTGTGCAAGCATGG + Intergenic
904788555 1:33000436-33000458 TTATTGAAGCTTTTCAAGCAGGG - Intergenic
904887556 1:33752485-33752507 TTCTGCAGGCTGTACAGGCATGG - Intronic
904887819 1:33754455-33754477 TTCTGCAGGCTGTACAGGCATGG - Intronic
905540132 1:38754049-38754071 TTCTGCAGTCTTTACAAGCATGG - Intergenic
906753534 1:48287716-48287738 TTCTGCAGGCTGTACAAGCATGG - Intergenic
907023240 1:51089099-51089121 TTCTGCAGGCTATACAAGCATGG + Intergenic
907607218 1:55830107-55830129 TTCTGCAACTTGTACAAGCATGG + Intergenic
908087148 1:60647768-60647790 TTCTGCAGGCTGTACAAGCATGG + Intergenic
908396271 1:63728441-63728463 TTCTGCAGGCTGTACAAGCATGG - Intergenic
908539861 1:65112079-65112101 TTCTGCAGGCTGTATAAGCATGG + Intergenic
908616669 1:65930046-65930068 GTCTTTAAGCTTGAGAAGCAAGG + Intronic
908733325 1:67249381-67249403 TTCTGAAAACTTCACAAACACGG - Intronic
908865651 1:68546625-68546647 TTCTGCAGACTGTACAAGCATGG + Intergenic
909103679 1:71381808-71381830 TTCTCTAAACATTACAAGTAGGG + Intergenic
909718203 1:78735956-78735978 TTCTGCAGGCTGTAAAAGCATGG + Intergenic
910302250 1:85719386-85719408 TTTTATAAACTTTACAAACATGG + Intergenic
910342200 1:86200943-86200965 TTCTCTAACCTTTACAGGTAAGG + Intergenic
910423748 1:87099282-87099304 TTCTGCAGGATGTACAAGCATGG + Intronic
910424134 1:87101897-87101919 TTCTGCAGGCTGTGCAAGCATGG + Intronic
910509115 1:87983930-87983952 TTCTGCAGGCTGTACAAGCATGG - Intergenic
910633241 1:89379092-89379114 TTCTGCAGGCTGTACAAGCATGG + Intronic
910738125 1:90484758-90484780 TTCTGCAGGCTGTACAAGCATGG - Intergenic
910777083 1:90887545-90887567 TTCTGTGGGCTGTACAAGCATGG - Intergenic
910904012 1:92154189-92154211 TCCTGCAGGCTGTACAAGCATGG - Intergenic
911138120 1:94464977-94464999 ATCTGCAGGCTGTACAAGCATGG + Intronic
911498336 1:98657504-98657526 TTCTGAAGCCTGTACAAGCATGG + Intergenic
911571934 1:99528061-99528083 TTCTGCAGGCTGTACATGCATGG + Intergenic
911590859 1:99746016-99746038 TTCTGCAGGCTGTACAAGCATGG - Intronic
911625548 1:100119827-100119849 TTCTGTAGGCTGTACAAGCATGG - Intronic
911661396 1:100505826-100505848 TTCTGTGGGCTGTACGAGCATGG + Intronic
912591896 1:110830682-110830704 TTCTGCAGGCTGTACAAGCATGG + Intergenic
912717844 1:111994559-111994581 TTCTGCAGGCTGTACAAACACGG - Intergenic
912761032 1:112367745-112367767 TTCTGTAGGCTGTACAAACATGG - Intergenic
912762926 1:112385174-112385196 TTCTGCAAGCTGTACAAGAGTGG - Intergenic
912878560 1:113387082-113387104 TTCTGCAGGCTGTACAAGCATGG - Intergenic
913166777 1:116194834-116194856 TTCCCTGAGCTTTATAAGCAAGG - Intergenic
913202527 1:116506810-116506832 TTCTGCAGGCTGTACAAGCAAGG - Intergenic
913330632 1:117664156-117664178 TTCTGCAGGCTGTACAAGAATGG - Intergenic
915295008 1:154914077-154914099 TTCTACAGGCTATACAAGCATGG - Intergenic
915438800 1:155930668-155930690 TTTTGAGAGCTTTACAAGGATGG - Intronic
916014141 1:160733611-160733633 TTCTGCAAGCTGTACAAGAATGG + Intergenic
916251418 1:162742331-162742353 TTCTGCAGGCTGCACAAGCATGG + Intronic
916287910 1:163131345-163131367 TTCTGCAGGCTACACAAGCATGG - Intronic
916288163 1:163133364-163133386 TTCTGCAGGCTGTACAAGCATGG - Intronic
916352738 1:163870370-163870392 TTCTGCAGGCTGCACAAGCATGG + Intergenic
916398773 1:164422534-164422556 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
916604123 1:166324268-166324290 TTCTGCAGGCTGTACAAGCATGG - Intergenic
917046004 1:170860875-170860897 TTCTACAGGCTGTACAAGCATGG - Intergenic
917408903 1:174737733-174737755 TTCTGCAAGCTGTACAGGCATGG + Intronic
917606008 1:176630144-176630166 TGCTGTAAGCTTTTGAAGAAAGG - Intronic
917759451 1:178140905-178140927 TTCTGTAGGCTATGCAAGCATGG + Intronic
917806745 1:178620721-178620743 TTCTGCAGGCTGTAAAAGCATGG + Intergenic
918157585 1:181864341-181864363 TTTTGTAGGCTTTATAGGCATGG + Intergenic
918631129 1:186719632-186719654 TACTGTAGGCTGTACATGCATGG - Intergenic
919032259 1:192257173-192257195 TTCTGCAGGCTGTACAAGCCTGG - Intergenic
919149616 1:193678981-193679003 TTCTGCAGGCTGTACAAGCATGG - Intergenic
919852127 1:201680075-201680097 TTCTGCAAGCTGTACAAGCAAGG + Intronic
919951511 1:202368415-202368437 TTCTGCAGGCTGCACAAGCATGG - Intronic
920163639 1:204019286-204019308 TTCTGCAGGCTGTACAAGAATGG - Intergenic
920553164 1:206882103-206882125 TTCTGCAGGCTGTACAAGTATGG - Intergenic
920677791 1:208050307-208050329 ATCTATTAGCTGTACAAGCATGG - Intronic
920890866 1:209984737-209984759 TTCTGCAGGCTGTATAAGCATGG + Intronic
920891232 1:209987348-209987370 TTTTGTAGGCTGTGCAAGCATGG + Intronic
920900503 1:210105962-210105984 TTCTGCAGGCTGTACAAGCATGG - Intronic
920972519 1:210754724-210754746 TTCTGCAGGCCATACAAGCATGG - Intronic
921296257 1:213706228-213706250 TTCTGCAAGCTTCACCACCATGG - Intergenic
921352083 1:214246260-214246282 GTCTGTAAGCTTGAGGAGCAAGG + Intergenic
921472005 1:215560884-215560906 TTCTGCAGGCTGTACAAGTATGG - Intergenic
921730969 1:218577467-218577489 TTCTGCAGGCTGTACAAGCATGG - Intergenic
921897411 1:220414736-220414758 TTCTGCAGGCTGTACAAGCATGG - Intergenic
922183059 1:223251211-223251233 TTCTGCAGGCTGTACCAGCATGG + Intronic
922277535 1:224092938-224092960 TTCTGCAGGCTGTACAAGCATGG - Intergenic
922335208 1:224613808-224613830 TTCTGCAGGCTGTACAAGCACGG - Intronic
922352064 1:224742504-224742526 TTCTGCAGGCTGTACGAGCATGG + Intergenic
922741506 1:228016711-228016733 TTCTGCAGGCTGTACAAGCATGG + Intronic
922862962 1:228835111-228835133 TTCTGCAGGCTGTACAAGCATGG + Intergenic
922999567 1:229995551-229995573 TTCTGCAAGCTGTACAAACATGG - Intergenic
922999583 1:229995786-229995808 TTCTGCAGGCTGTACAAGCATGG - Intergenic
923238868 1:232061250-232061272 TTCTGCAGGCTGTACTAGCATGG - Intergenic
923628745 1:235635605-235635627 TTCTGCAGGTTGTACAAGCATGG - Intronic
923657447 1:235930340-235930362 TTCTGTGAGCTTTACATAAATGG + Intergenic
923707612 1:236357525-236357547 TTCTTCCAGCTTTACAAGCGTGG + Intronic
923949074 1:238926690-238926712 TTCTGCAGGTTGTACAAGCATGG + Intergenic
923994986 1:239484167-239484189 TTCTGCAGGCTGTACAAGCATGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924287529 1:242503418-242503440 TTCTGCAAGCTGTACAAACATGG - Intronic
924324795 1:242884894-242884916 TTCTGCAAACAGTACAAGCATGG - Intergenic
924455448 1:244215440-244215462 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
924495778 1:244587057-244587079 GTATCTAAGCATTACAAGCAGGG + Intronic
924504858 1:244672437-244672459 TTCTGCAGGCTGTACAAGCATGG - Intronic
924767257 1:247045563-247045585 TTCTGCAGGCTGTACAAGCATGG - Intronic
1062770414 10:95989-96011 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1063024433 10:2164089-2164111 TTCTGAATGCTGAACAAGCATGG - Intergenic
1063094544 10:2898314-2898336 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1063550112 10:7024237-7024259 TTGTGTAGGCTGTACAAGCATGG - Intergenic
1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG + Intronic
1063814916 10:9760480-9760502 TTCTGCAAGCTGTACAATCAAGG + Intergenic
1064292970 10:14052413-14052435 TTTTGCAGGCTGTACAAGCATGG + Intronic
1064359884 10:14655022-14655044 TTCTGCAGGCTGTACAAGCATGG + Intronic
1064555892 10:16546719-16546741 TTCTTCAAGCTGTGCAAGCATGG - Intergenic
1064834732 10:19513383-19513405 TTCTGCAAGCTGTATAAGCATGG - Intronic
1065002363 10:21348495-21348517 TTCTGCAGGATGTACAAGCATGG + Intergenic
1065078614 10:22105460-22105482 TTCTGCAGACTGTACAAGCATGG - Intergenic
1065281991 10:24148707-24148729 TTCTGCAAGCTGTACAAGCATGG - Intronic
1065448137 10:25824069-25824091 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1065904029 10:30232633-30232655 TTCTGCAGGCTATATAAGCATGG - Intergenic
1066066452 10:31764746-31764768 TTCTGCAGACTGTACAAGCATGG - Intergenic
1066201714 10:33148046-33148068 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1066498867 10:35970835-35970857 TTCTGCAGGCCTTACAAGGATGG - Intergenic
1066552397 10:36573603-36573625 TTCTTTTGTCTTTACAAGCAGGG + Intergenic
1066585024 10:36923355-36923377 TCCAGTAAGCTTTACTAGAAAGG + Intergenic
1067137790 10:43626538-43626560 TTCCGCAGGCTGTACAAGCATGG - Intergenic
1068047109 10:51900054-51900076 TTCTGCAGGCTGTAAAAGCATGG - Intronic
1068148333 10:53099547-53099569 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1069130768 10:64699352-64699374 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1069650537 10:70043897-70043919 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1069742351 10:70692971-70692993 TTCTGCAGGCTGTACCAGCATGG + Intronic
1070245625 10:74728893-74728915 TTCTGTAGGCTGTACAAACATGG - Intergenic
1070246025 10:74731740-74731762 TTCTGCAGGCTGTCCAAGCATGG - Intergenic
1070522095 10:77262802-77262824 TTCTGCAGGCTGTACAAGCATGG - Intronic
1071119610 10:82262078-82262100 TTCTGCAGGCTTTCCAATCATGG - Intronic
1071147112 10:82588463-82588485 TTCTGCAGGCTGTACAACCATGG - Intronic
1071203784 10:83251527-83251549 CTCTGCAAGCTGTACAAGCATGG + Intergenic
1071242823 10:83727279-83727301 TTCTGTGGGCTGTACAAGCATGG - Intergenic
1071757125 10:88555592-88555614 TTCTGCGGGCTATACAAGCATGG - Intronic
1072233066 10:93429315-93429337 TTCTGCAGGCTGTACAAGCATGG - Intronic
1072491497 10:95910338-95910360 TTCTGCAGGCTATATAAGCATGG + Intronic
1073688912 10:105786008-105786030 TTCTGCAGGCTGCACAAGCATGG + Intergenic
1074260166 10:111845687-111845709 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1074440285 10:113471910-113471932 TTCTGCAGGCTCTACAAGCATGG + Intergenic
1074927293 10:118086172-118086194 TTCTGCAGGCTATACAAGCATGG + Intergenic
1075312945 10:121430022-121430044 TTCTGCAAATTGTACAAGCATGG + Intergenic
1075443736 10:122499419-122499441 TTCTGTATGCTTTATGAACAAGG + Intronic
1075576169 10:123579108-123579130 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1076046079 10:127295172-127295194 TTCTGCAGGCTGTACAAGCGTGG + Intronic
1076191903 10:128489074-128489096 CTCTCTCTGCTTTACAAGCAAGG + Intergenic
1076287300 10:129312762-129312784 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1076465666 10:130679855-130679877 TTCTGCAGGCTATAGAAGCATGG - Intergenic
1076561248 10:131366205-131366227 TTCTGCAGTCTGTACAAGCATGG + Intergenic
1077258185 11:1598815-1598837 TTCTGCAGGCTGCACAAGCATGG + Intergenic
1077941695 11:6849647-6849669 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1078087975 11:8245842-8245864 TTCTGTAGGTTGTACAAGCATGG + Intronic
1078512131 11:11992780-11992802 TTCTGCAGGCTATACGAGCATGG - Intronic
1078905622 11:15685661-15685683 TTCTACAGGCTATACAAGCATGG + Intergenic
1079065692 11:17289306-17289328 TTTTACAAGCTTTACAAGCTTGG + Intronic
1079086188 11:17446831-17446853 AACTCTAAGCTTTACAAGTAAGG + Intronic
1079254145 11:18812042-18812064 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1079349764 11:19682586-19682608 TTCTGAAGGCTATACAAGCATGG + Intronic
1079737168 11:24011919-24011941 TTCTGTAGGCTTTATAAACACGG - Intergenic
1080044480 11:27794872-27794894 TTCTGCAGGCTATACAAGGATGG + Intergenic
1080109931 11:28555225-28555247 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1080255964 11:30290898-30290920 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1080338409 11:31227219-31227241 TTCTGTAGACTGTACAAGCATGG + Intronic
1080547236 11:33332848-33332870 TTCTGCAGGCTGTACAAGCAGGG + Intronic
1080562164 11:33473927-33473949 TTCTGCGGGCTGTACAAGCATGG + Intergenic
1080831014 11:35893285-35893307 TTCTGCAGGCTATACAAGCATGG - Intergenic
1080878755 11:36300209-36300231 TTCTGCAGGCTGTACAAGCATGG + Intronic
1081019613 11:37929202-37929224 TATTGTAAGCATTAGAAGCAAGG + Intergenic
1081243176 11:40731474-40731496 TTCTGTAGGCTGTACAAGCATGG - Intronic
1081286408 11:41275184-41275206 TTCTGTAGGCTTCACAGGCATGG - Intronic
1081404711 11:42683593-42683615 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1081529283 11:43947054-43947076 TTCTGCAGGCTATACAAGCATGG + Intergenic
1081650556 11:44820952-44820974 TTCTACAGGCTGTACAAGCATGG - Intronic
1081682539 11:45018326-45018348 TTCTGCAGGCTGTACAAACATGG + Intergenic
1081788223 11:45763540-45763562 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1082862192 11:57867422-57867444 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1082930016 11:58592841-58592863 TTCTGCAGGCTGTACAAGCATGG + Intronic
1083964926 11:66037590-66037612 TTCTGCAGGCTGTACAGGCATGG - Intergenic
1083987286 11:66223804-66223826 TTCTGTAAGTTTTATAAGTCAGG - Intronic
1084309034 11:68305366-68305388 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1084798382 11:71524714-71524736 TTCTGCTAGTTGTACAAGCATGG - Intergenic
1084798675 11:71526733-71526755 TTCTGCAGGCTGCACAAGCATGG - Intergenic
1084803772 11:71564995-71565017 TTCTGCAGGCTGCACAAGCATGG - Intronic
1085057924 11:73418456-73418478 TTCTGCAGGCTGCACAAGCATGG - Intronic
1085193829 11:74653870-74653892 TTCTGCAGGCTGTACAAGCATGG + Intronic
1085362417 11:75902360-75902382 TACTGTAAACTATACATGCAAGG - Intronic
1085383971 11:76145578-76145600 TTCTGCAGGCTATATAAGCATGG - Intergenic
1085690999 11:78663631-78663653 TTCTGCAGGCTCTATAAGCATGG - Intronic
1085883023 11:80489883-80489905 GACTGTAAGATTTACAAGGAGGG + Intergenic
1085903165 11:80726794-80726816 TCCAGTAAGCTTTACTAGAAAGG - Intergenic
1085986537 11:81794172-81794194 TTCTGTAGGCTGTAAAAGCATGG - Intergenic
1085989190 11:81820484-81820506 TTCTGCAGGCTCTGCAAGCATGG + Intergenic
1086005884 11:82035220-82035242 TTCTGTAAGCTATACAAGAATGG + Intergenic
1086385009 11:86298188-86298210 TTCTGCAGGCTGTACCAGCATGG + Intergenic
1086391519 11:86369990-86370012 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1086553927 11:88087390-88087412 TTCTGCAGGCTTTACAGGCATGG + Intergenic
1086871445 11:92042132-92042154 TTCTGCAGGCTCTACTAGCATGG - Intergenic
1087301212 11:96438795-96438817 TTCTGCAGGCTGTATAAGCATGG + Intronic
1087699255 11:101417280-101417302 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1088109494 11:106245900-106245922 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1088136521 11:106562200-106562222 TTCTGCAGACTGTACAAGCATGG - Intergenic
1088421149 11:109648418-109648440 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1088453915 11:110013876-110013898 CTCTGCAGGCTGTACAAGCATGG + Intergenic
1088454060 11:110015102-110015124 TTCTGCAAGCTGTACAAGCATGG + Intergenic
1088546601 11:110965784-110965806 TTCTGCAGGCTGTAAAAGCATGG + Intergenic
1088923372 11:114278114-114278136 TTCTGCAGGCTGTACAAGCATGG + Intronic
1089187386 11:116628598-116628620 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1089575752 11:119441869-119441891 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1089584838 11:119503676-119503698 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1089821205 11:121227836-121227858 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1089901812 11:121994187-121994209 TCCTGCAGGCTGTACAAGCATGG - Intergenic
1089929912 11:122299591-122299613 TTCTGCAGGCTATACAAACACGG + Intergenic
1090257955 11:125299007-125299029 TTCTGCAGGCTGTACAAGCATGG + Intronic
1090521356 11:127482995-127483017 TTCTGCAGGCTATACAAGGATGG + Intergenic
1090830985 11:130420700-130420722 TTTTGTTAGCCCTACAAGCAGGG + Intronic
1090860306 11:130647215-130647237 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1091211701 11:133866112-133866134 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1091662615 12:2395903-2395925 TTATTTAATCTTTACAAGCCAGG + Intronic
1091852590 12:3712352-3712374 TTCTGCAAGCTATGCAAGCATGG + Intronic
1091960849 12:4692894-4692916 TTCTGTAGGCTGTACAAGCATGG + Exonic
1091989803 12:4946277-4946299 TTCTGCAGGCTATACAAGCATGG + Intergenic
1092080425 12:5711437-5711459 TTCTGCAGGCTGTACAAGCATGG - Intronic
1092555471 12:9556176-9556198 TCCTGTAATTTTTACAAGCAAGG + Intergenic
1092701255 12:11233592-11233614 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1093070690 12:14705097-14705119 TTCTGCAGGCTGTACGAGCATGG + Intergenic
1093415511 12:18915685-18915707 TTCTGTAAGCTTTGCAATGATGG + Intergenic
1093613709 12:21194817-21194839 TTCTGCAAGCTGTACAGGCATGG + Intronic
1093698383 12:22189276-22189298 TTCTGCAAACTGTACAAGCAGGG - Intronic
1093730420 12:22559909-22559931 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1094068142 12:26383245-26383267 TTCTGCAGGCTGTACAAACATGG - Intronic
1094144091 12:27210820-27210842 TTCTGTAGGCTGTACAAGCGTGG - Intergenic
1094169955 12:27480821-27480843 TTCTGTAAGCTGTACAGGCATGG - Intronic
1094408109 12:30140256-30140278 TTCTGCAAGCTGTACAAGCATGG - Intergenic
1094428051 12:30336558-30336580 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1094516626 12:31134498-31134520 TCCTGTAATTTTCACAAGCAAGG - Intergenic
1095143692 12:38697915-38697937 TTCTGCAGGCTGTATAAGCATGG - Intronic
1095175589 12:39088675-39088697 TTCTGTAGGCCATGCAAGCATGG + Intergenic
1095520487 12:43058526-43058548 TTCTGCAGGCTGTACAAACATGG - Intergenic
1095542324 12:43324886-43324908 TTCTGTAGGCTGTGTAAGCATGG - Intergenic
1095730178 12:45498122-45498144 TTCTGCAGGCTGCACAAGCATGG + Intergenic
1097533902 12:60840759-60840781 TTCTGCAAGATGTACAAGGATGG + Intergenic
1097870305 12:64596446-64596468 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1098055661 12:66502761-66502783 TTCTGCAGGCTGTACAAGCATGG - Intronic
1098470031 12:70832780-70832802 TTCTGCAGGCTGTACAAGCATGG + Intronic
1098608087 12:72419403-72419425 TTCTGCAAGCTGTACAAGTATGG + Intronic
1098655240 12:73019817-73019839 TTCTGCAAGCTGTACAAGCATGG - Intergenic
1098745874 12:74236053-74236075 TTGTACAAGCTGTACAAGCATGG - Intergenic
1098966764 12:76798710-76798732 TTCAGGAAACTTTACAATCATGG + Intronic
1099057470 12:77862589-77862611 TTCTGTAACCCTTCCCAGCAAGG + Intronic
1099544184 12:83955891-83955913 CTCTGCAGGCTATACAAGCATGG + Intergenic
1099703813 12:86124522-86124544 TTTTGTGAGCTTTACCAGGATGG - Intronic
1099871218 12:88351746-88351768 TTCTGCAAGCTGTACAAGCATGG + Intergenic
1100002534 12:89854941-89854963 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1100052278 12:90462760-90462782 TTCTGCAGGCTGCACAAGCAAGG + Intergenic
1100095276 12:91026557-91026579 TTCTGCAGGCTGTACAATCATGG + Intergenic
1100208444 12:92376429-92376451 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1100465010 12:94836715-94836737 TTCTGCAGGCTGTACATGCATGG + Intergenic
1100692567 12:97054127-97054149 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1100915951 12:99422042-99422064 TTCTGCAGGCTGTGCAAGCATGG - Intronic
1101353369 12:103954347-103954369 TTCTGCAGGCTGTACAAGCATGG + Intronic
1101419992 12:104543043-104543065 TTCTGCAGGCTGTACAAGCATGG + Intronic
1101542664 12:105679004-105679026 GTCTGCAAGCTTGAGAAGCAAGG - Intergenic
1101636061 12:106542410-106542432 TTCTGCAGGCTCTACAAGCATGG + Intronic
1101918329 12:108912984-108913006 TTCTGCAGGCTGTACAAGCATGG - Intronic
1102381067 12:112467349-112467371 TTCTGAAGGCTGTACAAGCATGG + Intronic
1102725834 12:115063804-115063826 ATCTGCAGGCTGTACAAGCATGG - Intergenic
1103024294 12:117560930-117560952 TTCTGCAGGCTGTACAAGTATGG - Intronic
1103262596 12:119601273-119601295 TTCTGTAAACTTTGAAAGAAAGG + Intronic
1103594421 12:122015377-122015399 TACTATAGGCTTTACAAACATGG + Intergenic
1104118232 12:125771460-125771482 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1104183317 12:126403876-126403898 TTCTTCAGGCTGTACAAGCACGG + Intergenic
1104358845 12:128113277-128113299 GTCAGTAAGGTTTCCAAGCACGG + Intergenic
1104358851 12:128113345-128113367 GTCAGTAAGGTTTCCAAGCATGG + Intergenic
1104358854 12:128113379-128113401 GTCAGTAAGATTTCCAAGCATGG + Intergenic
1104358857 12:128113413-128113435 GTCTGCAAGGTTTCCAAGCATGG + Intergenic
1104358867 12:128113515-128113537 GTCAGTAAGGTTTCCAAGCATGG + Intergenic
1104358873 12:128113584-128113606 GTCAGTAAGGTTTCCAAGCACGG + Intergenic
1104358877 12:128113618-128113640 GTCAGTAAGGTTTCCAAGCATGG + Intergenic
1104358881 12:128113652-128113674 GTCAGTAAGGTTTCCAAGCATGG + Intergenic
1104358884 12:128113686-128113708 GTCAGTAAGGTTTCCAAGCATGG + Intergenic
1104359092 12:128115255-128115277 GTCAGTAAGGTTTCCAAGCATGG - Intergenic
1104370675 12:128221387-128221409 TTCTGCAGGCTGCACAAGCATGG + Intergenic
1104644564 12:130487542-130487564 TTCTGCAGGCTGTACAAGCATGG - Intronic
1105734493 13:23253965-23253987 TTCTGCAGGCTGTACAAACATGG - Intronic
1106301321 13:28468805-28468827 TTCTCCAGGCTGTACAAGCATGG - Intronic
1106811435 13:33362140-33362162 TTCTGCAGGCTGTACAAGCGAGG + Intergenic
1107021116 13:35752709-35752731 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1107050751 13:36046164-36046186 TTCTGCAAGCTTATTAAGCAAGG - Intronic
1107417800 13:40217466-40217488 TTTTGTAGGCTGTACAAGCATGG - Intergenic
1107552972 13:41494311-41494333 TTCTGTAATGTCGACAAGCAAGG - Intergenic
1107799255 13:44088684-44088706 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1107816243 13:44247010-44247032 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1107823440 13:44306497-44306519 TTATGTAAGATGTAAAAGCAGGG - Intergenic
1108069624 13:46615195-46615217 TTCTGCAGGCTCTGCAAGCATGG + Intronic
1108714580 13:53066332-53066354 TTCTGTATGTCTTGCAAGCATGG - Intergenic
1109711174 13:66162565-66162587 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1109828961 13:67761000-67761022 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1109889393 13:68588766-68588788 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1110241870 13:73276763-73276785 TTCTGCAGGCTATACAAACATGG - Intergenic
1110723898 13:78796985-78797007 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1110797520 13:79657438-79657460 TTCTACAGGCTATACAAGCATGG - Intergenic
1110832575 13:80048070-80048092 TGCTGTAAGCTATAGAACCATGG + Intergenic
1110839879 13:80129792-80129814 TGCTGTGAGAATTACAAGCAAGG + Intergenic
1111283906 13:86063750-86063772 TTCCGCAGGCTATACAAGCATGG + Intergenic
1111643662 13:91002703-91002725 TTATGCAGGCTGTACAAGCATGG - Intergenic
1111807822 13:93059703-93059725 TTCTGCAGGCTGTACAAGCAAGG - Intergenic
1111813335 13:93119623-93119645 TTCTACAGGCTGTACAAGCATGG + Intergenic
1111937395 13:94571124-94571146 TTCTGCAGGCTGTACAATCATGG + Intergenic
1111968090 13:94881343-94881365 TTCTACAGGCTGTACAAGCATGG + Intergenic
1112124649 13:96451441-96451463 TTATCTTAGCTTTCCAAGCAAGG + Intronic
1112179345 13:97062272-97062294 TTCTGCAGGCTGTATAAGCACGG + Intergenic
1112182917 13:97103083-97103105 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1112314840 13:98351664-98351686 TTCTGTAGGCTCTATAAGCATGG + Intronic
1112437777 13:99403958-99403980 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1112450869 13:99508596-99508618 TTCTGCAGGCTGTACAAGCATGG + Intronic
1112656829 13:101460679-101460701 TTTTGCAGGCTGTACAAGCAAGG + Intronic
1112860133 13:103820022-103820044 TTCTGAAGGCTGTACAAGAATGG + Intergenic
1112999044 13:105610842-105610864 TTCTGCAGACTGTACAAGCATGG + Intergenic
1113012424 13:105784935-105784957 TTCTGCAGGCTATACAAGAAGGG - Intergenic
1113182862 13:107651254-107651276 TTCTGTATTCTTTACTTGCACGG + Intronic
1113615236 13:111675865-111675887 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1113620703 13:111760778-111760800 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1113825149 13:113246983-113247005 TTCTGCAGGCTATACAAGCATGG + Intronic
1113968574 13:114170194-114170216 TTCTGAAAACTTCAAAAGCATGG - Intergenic
1114081513 14:19204698-19204720 TAATGCAAGCTGTACAAGCATGG - Intergenic
1114590647 14:23861622-23861644 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1114764225 14:25352003-25352025 TTTTGTAAGCTCTACAGGTATGG + Intergenic
1114789111 14:25635928-25635950 TTCTGCAGGCTATACAAGCACGG - Intergenic
1115115443 14:29876203-29876225 TGCTGCATGTTTTACAAGCAGGG - Intronic
1115116177 14:29883012-29883034 TTCTGCAGGCTATACAAGCATGG + Intronic
1115150299 14:30276767-30276789 TTCTGCAGGATGTACAAGCATGG - Intergenic
1115715289 14:36096970-36096992 TTTTGCAGGCTGTACAAGCATGG + Intergenic
1115874657 14:37846737-37846759 TTCTGCAGGCTTTACAAGCAGGG - Intronic
1115929165 14:38471513-38471535 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1116059229 14:39899560-39899582 GTCTGCAAGCTTGAGAAGCAAGG - Intergenic
1116340810 14:43721636-43721658 TTCTGTATGCTGTACAAGCATGG + Intergenic
1116352863 14:43887576-43887598 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1116475574 14:45335075-45335097 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1116521124 14:45848367-45848389 TTCTGTAGGCTATACAAGCATGG + Intergenic
1116589085 14:46748056-46748078 TTCTACAGGCTGTACAAGCATGG - Intergenic
1116646157 14:47531537-47531559 TTATCCAAGGTTTACAAGCAAGG - Intronic
1117281229 14:54242990-54243012 TTCTGGAGGCTGTACAAGCATGG + Intergenic
1117317071 14:54581648-54581670 TACTGGAATCTTTACAGGCAGGG - Intronic
1117451545 14:55855143-55855165 TTCTCTAAGGTATACAAGTACGG + Intergenic
1117507153 14:56415395-56415417 TTCTGTAAGCTGGAAAACCAGGG + Intergenic
1119052448 14:71383579-71383601 TTCTGCAAGCGGTACTAGCATGG + Intronic
1119060371 14:71468351-71468373 TTCTGCATGCTGTACAAGCATGG + Intronic
1119282589 14:73422558-73422580 TTCTGCAGGATATACAAGCATGG + Intronic
1120227616 14:81808826-81808848 TTCTGTAGGCTGTACAGGCATGG - Intergenic
1120397859 14:83991278-83991300 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1120466426 14:84863558-84863580 TTCTGCAGGCTTTACAAGCATGG - Intergenic
1120514707 14:85456980-85457002 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1120515620 14:85466032-85466054 TTCTGGAGGCTATACAAGCATGG - Intergenic
1120802320 14:88704371-88704393 TTCTGCAGGCTGTACAAGCAGGG - Intronic
1121139112 14:91525367-91525389 CTCTGCAGGCTGTACAAGCATGG + Intergenic
1121257457 14:92541169-92541191 TGCTGTAACCATTACAAGAATGG - Intronic
1121303975 14:92893861-92893883 TTCTGCAGACTGTACAAGCATGG - Intergenic
1121462874 14:94095525-94095547 TTCTGTAGGTTATACAAGCATGG + Intronic
1121513197 14:94529278-94529300 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1121596630 14:95168322-95168344 ATCTGGAGGCTATACAAGCATGG - Intergenic
1121860530 14:97313548-97313570 TTCTGTAGGCTGTACAAGCATGG - Intergenic
1122014319 14:98780947-98780969 GTCTGCAAGCTTGAGAAGCAAGG - Intergenic
1122414899 14:101544732-101544754 TTCTGCAGGCTGTACAAGCCTGG + Intergenic
1123187640 14:106535738-106535760 TACTGTAAACTTTATTAGCAAGG + Intergenic
1123207405 14:106726674-106726696 TACTGTAACCTTTACCAGCAAGG + Intergenic
1123212432 14:106773668-106773690 TACTGTAACCTTTACCAGCAAGG + Intergenic
1123776755 15:23588262-23588284 TTCAGTAATCTTTATCAGCAAGG - Intronic
1123820191 15:24021758-24021780 TTCTGGAAGCTGTAGATGCAGGG + Intergenic
1123962615 15:25421320-25421342 TGCTGCAGGCTGTACAAGCATGG - Intronic
1124203658 15:27699196-27699218 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1125406337 15:39355792-39355814 TTCTGTAGGCTGTACAAGCATGG - Intergenic
1125544767 15:40495057-40495079 TTCTGCAGGCTCTACAAGCGTGG + Intergenic
1125805672 15:42491464-42491486 TTCAGAAAGTTTTACAAGGAAGG - Intronic
1126029813 15:44485510-44485532 TACTGTGAACTTTACATGCAAGG - Intronic
1126383750 15:48073562-48073584 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1127008519 15:54596889-54596911 TTCTGCAGGCTATACAAGCATGG - Intronic
1127271045 15:57402367-57402389 TTCTGCAGGCTGTGCAAGCATGG - Intronic
1127290982 15:57570832-57570854 TTCTGTAGGCTGTACAAGCATGG - Intergenic
1127375938 15:58384289-58384311 TTCTGCAGGCTGTACAAGAATGG - Intronic
1127563086 15:60159862-60159884 TTCATCAAGCTTTGCAAGCAGGG - Intergenic
1127692840 15:61414732-61414754 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1128427324 15:67555174-67555196 TTCTACAGGCTGTACAAGCATGG + Intronic
1128629709 15:69252291-69252313 TTCTGCAGGCTATACAAACATGG + Intronic
1128900219 15:71413903-71413925 TTCAGTAACATTTAGAAGCAGGG - Intronic
1129201753 15:74006714-74006736 TTCTGCATGCTGTACAATCATGG + Intronic
1129688852 15:77701817-77701839 TTCTGCAGGCCGTACAAGCATGG - Intronic
1129996956 15:80015217-80015239 TTCTGCAGGCTATAAAAGCATGG + Intergenic
1130081731 15:80739699-80739721 TTCTGCAGGCTGTACAAGCATGG - Intronic
1130141978 15:81235273-81235295 TTCTGCAAGCTATACAAGCATGG + Intronic
1130747186 15:86667916-86667938 TTCTGCAGGCTGTAAAAGCATGG + Intronic
1131205418 15:90441590-90441612 CTCTTCAAGATTTACAAGCATGG - Exonic
1131352452 15:91713603-91713625 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1131491441 15:92866779-92866801 TTCTGCAGGCTGTACAATCATGG + Intergenic
1131592906 15:93768725-93768747 TTCTGCAGGCTACACAAGCAAGG + Intergenic
1131694666 15:94863688-94863710 TTCTTCAGGCTGTACAAGCATGG + Intergenic
1131705520 15:94991606-94991628 TTGTGCAGGCTGTACAAGCATGG + Intergenic
1131771769 15:95745633-95745655 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1133452275 16:5913589-5913611 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1133535820 16:6701484-6701506 TTATGTAGGTTGTACAAGCATGG + Intronic
1133644658 16:7753283-7753305 TTCTGCGAGCTGTACAAGCATGG + Intergenic
1133677024 16:8082861-8082883 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1133878065 16:9753247-9753269 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1134029437 16:10979950-10979972 TTATGTAATATTTACAAGAAGGG + Intronic
1134082530 16:11335006-11335028 TTCTGCAGGCTGTACAAGCATGG + Intronic
1134647559 16:15882209-15882231 TTCTGCAGACTGTACAAGCATGG - Intronic
1134753128 16:16642264-16642286 TTGTGCAGGCTGTACAAGCATGG + Intergenic
1134992929 16:18716812-18716834 TTGTGCAGGCTGTACAAGCATGG - Intergenic
1135483684 16:22844767-22844789 CTCAGGAAGCTTTACAATCATGG - Intronic
1135850686 16:25960274-25960296 TTCTGCAGACTGTACAAGCATGG - Intronic
1135873157 16:26170722-26170744 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1135977190 16:27116260-27116282 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1136096056 16:27957776-27957798 TTCTGCAGGCTGTATAAGCATGG + Intronic
1137501012 16:49011797-49011819 TTCTGCAGGCTATATAAGCATGG + Intergenic
1137700880 16:50496879-50496901 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1137936330 16:52638565-52638587 TTCTGAAGACTGTACAAGCATGG + Intergenic
1138133531 16:54501994-54502016 TTCTGCAGGCTGTACAAGAATGG + Intergenic
1138613638 16:58147028-58147050 TTCTGCAGGCTGTACCAGCATGG - Intergenic
1138726081 16:59140794-59140816 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1138795855 16:59968186-59968208 TTCTGCAGGCTGTACAAGCGTGG + Intergenic
1138996138 16:62455135-62455157 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1139141399 16:64267221-64267243 TTCTACAAGCTATACAAGCATGG + Intergenic
1139160070 16:64494170-64494192 TTCTGCAGGCTATACAAGCATGG - Intergenic
1139284134 16:65795779-65795801 TTCTGGAAGCTTGACCTGCATGG + Intergenic
1140288571 16:73628369-73628391 TTCTGTAAGCTTGAAAAATAGGG - Intergenic
1140297863 16:73726581-73726603 TTCTGAAGGCTATATAAGCACGG + Intergenic
1140920351 16:79531844-79531866 TTTTCTAATCTTTTCAAGCAGGG - Intergenic
1141125235 16:81396485-81396507 TTCTGCAGGCCATACAAGCATGG + Intergenic
1141248453 16:82332689-82332711 TTCTGCAGGCTGTACAAGCTTGG - Intergenic
1141758749 16:86012958-86012980 TTCTGTGGGGTGTACAAGCATGG + Intergenic
1142542526 17:671402-671424 TGCTGTATGAGTTACAAGCAAGG + Intronic
1143997890 17:11023803-11023825 TTCTGCAGGCTGTAGAAGCATGG - Intergenic
1144375972 17:14641876-14641898 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1144393966 17:14825266-14825288 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1145417099 17:22726252-22726274 TTCTGAAAGTATTACAAACATGG + Intergenic
1145770251 17:27487621-27487643 TTCTGCAGGCTGTACAAGCATGG + Intronic
1146296254 17:31653042-31653064 CTCTGCAGGCTGTACAAGCATGG + Intergenic
1146981217 17:37163370-37163392 TTCTGCAGGCTCTATAAGCATGG - Intronic
1148660629 17:49328721-49328743 TTCTGCAGGCTGTACAAGCCTGG - Intronic
1149016844 17:51917521-51917543 TTCTGTAGGCTATATAAGCATGG + Intronic
1149246522 17:54714728-54714750 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1149281663 17:55111719-55111741 TTCTGTAGGCTATACAAACATGG - Intronic
1150938113 17:69659596-69659618 TTCTGCAGGCAGTACAAGCATGG + Intergenic
1150968076 17:69994790-69994812 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1151136184 17:71947577-71947599 TTCTGCAGGCTATACAAGCATGG - Intergenic
1152370229 17:79883242-79883264 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1153087749 18:1307856-1307878 TTCTGCAGGCTGTACAAGCTTGG + Intergenic
1153171407 18:2320044-2320066 TTCTGCAAGCTGTATAAGCATGG - Intergenic
1153232702 18:2955256-2955278 TTCTGCAGGCTGTACAAGCACGG + Intronic
1153250730 18:3119086-3119108 CTCTGTAAGAGTTACAAGCAAGG + Intronic
1153345554 18:4021504-4021526 TTCTGGAGGCTGTACAAGCATGG - Intronic
1153615758 18:6931411-6931433 TTCTGCAAGTTGTACAAGCATGG - Intergenic
1153657703 18:7299611-7299633 GTCTGTAGGCTGTACAAGTATGG - Intergenic
1153744023 18:8158681-8158703 TTCTGCAGGCTTTACAAGCATGG + Intronic
1154256291 18:12783454-12783476 TGCTGTGAGCTGCACAAGCAAGG + Intergenic
1154946502 18:21166805-21166827 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1155295202 18:24378554-24378576 TAATGTAATCTTTATAAGCATGG - Intronic
1155683187 18:28515012-28515034 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1155688088 18:28580453-28580475 TTCTACAGGCTGTACAAGCATGG + Intergenic
1155795969 18:30036722-30036744 TTCTACAGGTTTTACAAGCATGG + Intergenic
1155808459 18:30202193-30202215 TTCTGCATGCTATAGAAGCATGG + Intergenic
1156077638 18:33300253-33300275 TTCTGCAGGCTATAGAAGCATGG - Intronic
1156099145 18:33572753-33572775 TTCTGCAAGTTTTAAAAGGATGG - Intergenic
1156678269 18:39557615-39557637 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1156858455 18:41810262-41810284 TTCTGTAAAGTATAGAAGCAGGG - Intergenic
1156860580 18:41831574-41831596 TTCTGAAACCTTTGTAAGCACGG - Intergenic
1157049908 18:44151526-44151548 TTCTGCAGACTGTACAAGCATGG + Intergenic
1157516763 18:48316727-48316749 TTCTGCAGGCTGTGCAAGCATGG - Intronic
1158417062 18:57257753-57257775 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1158904904 18:62002322-62002344 TTTTGCAGGCTATACAAGCATGG + Intergenic
1158925166 18:62249648-62249670 AGCTGTTAGCTTTACATGCAAGG - Intronic
1159362207 18:67420019-67420041 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1159542962 18:69802790-69802812 TTCTGCAGGCTGTACAAGCATGG - Intronic
1159741615 18:72178463-72178485 TTCTCCAAGTTGTACAAGCACGG + Intergenic
1159925502 18:74265657-74265679 TTCTGCAGCCTGTACAAGCACGG + Intronic
1159960094 18:74548468-74548490 TTCTGAAGGCTGTATAAGCATGG - Intronic
1160010015 18:75100234-75100256 TTCTGTGAGCTGCATAAGCATGG + Intergenic
1160010291 18:75102239-75102261 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1160121610 18:76135307-76135329 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1163056651 19:14725032-14725054 TTCTGCAGGCTCTACAAGCATGG + Intronic
1164451741 19:28372020-28372042 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1164597281 19:29538622-29538644 TTCTGCAGGCTGTGCAAGCAAGG + Intronic
1164675977 19:30101818-30101840 TTCTGCAGGCCATACAAGCATGG + Intergenic
1164851323 19:31486659-31486681 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1164852283 19:31494034-31494056 TTATGTAAACTTTACAACAAAGG - Intergenic
1164858537 19:31544274-31544296 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1164884466 19:31766098-31766120 TTCTGTAGGCTGTGCAAGTATGG - Intergenic
1164896457 19:31881544-31881566 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1164921305 19:32090533-32090555 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1165147722 19:33742335-33742357 TTCTGCAGGCTGTACAAGCGTGG + Intronic
1165191397 19:34066716-34066738 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1165269727 19:34695673-34695695 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1165288985 19:34867941-34867963 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1166651673 19:44579830-44579852 TTCTGCAGACTGTACAAGCATGG - Intergenic
1167653069 19:50743875-50743897 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1167977209 19:53238531-53238553 TTCTGTTGGATTTACAAGCAAGG - Exonic
1168448389 19:56444218-56444240 TTCAGTAGGCTGTACAAGCATGG + Intronic
925313394 2:2904145-2904167 TTGTGTAATCTTTGAAAGCAGGG - Intergenic
925357305 2:3250899-3250921 TTCTGCAGGCTATATAAGCATGG - Intronic
925559960 2:5180992-5181014 TTCTGCAGGCTATACAGGCACGG + Intergenic
925758341 2:7156888-7156910 TTCTGCAGGCTGTACAAGCATGG - Intergenic
925889735 2:8424013-8424035 TTCTGCAGGCTGTACAAGCATGG + Intergenic
925907825 2:8549864-8549886 TTCTGCTGGCTGTACAAGCATGG - Intergenic
926563472 2:14444029-14444051 TTCTACAGGCTGTACAAGCATGG + Intergenic
926630506 2:15131755-15131777 TTCTGCAGGATGTACAAGCATGG + Intergenic
926849142 2:17175520-17175542 TTCTGCAGGCTGTATAAGCATGG + Intergenic
927062222 2:19434276-19434298 TTCTGCAGACTATACAAGCATGG - Intergenic
927332219 2:21878810-21878832 TTCTACAGGCTATACAAGCATGG + Intergenic
927740193 2:25561802-25561824 TTCTGCAGGCTGTGCAAGCATGG - Intronic
928318822 2:30267105-30267127 TTCTGCAGGCTGTACAGGCATGG + Intronic
928353278 2:30583315-30583337 TTCTGTAAACTTTAAGATCATGG + Intronic
928514638 2:32034301-32034323 TTCTGCAAGCTACACAAGCATGG + Intronic
929255110 2:39802251-39802273 ATCTGCAAGCTGAACAAGCATGG + Intergenic
929407238 2:41656720-41656742 TTCTACAGGCTGTACAAGCATGG - Intergenic
929547924 2:42868060-42868082 TTCTGCAGGCCGTACAAGCATGG + Intergenic
929565582 2:42982099-42982121 TTCTGCAGGCTGTACAGGCATGG + Intergenic
929695253 2:44109156-44109178 TTCTGCAGGCTGTACAAGCATGG - Intergenic
929828265 2:45327499-45327521 TTCTGCAAGCTGTGCAAGGATGG - Intergenic
929894309 2:45945241-45945263 TTCTGCAGGCTGTACAAGCATGG + Intronic
930118428 2:47739962-47739984 TTCTGTAGGCTGTACAAGCATGG + Intronic
930276998 2:49323323-49323345 TTCTGCAGGCTGTACAAGCATGG + Intergenic
930384466 2:50676267-50676289 TTCTATAGGTTATACAAGCATGG - Intronic
930727028 2:54692438-54692460 TTCTGCAGGCTGTACAAGCATGG - Intergenic
930906519 2:56574842-56574864 TTCCATAGGCTATACAAGCATGG - Intergenic
931056769 2:58481406-58481428 TTCTGCAGGCTGTACAAGCATGG + Intergenic
931148008 2:59541117-59541139 TTCTGCAAGCTGTACAAGCATGG - Intergenic
932070107 2:68611670-68611692 TTCTGTGGGCTGTGCAAGCATGG + Intronic
932903935 2:75729752-75729774 TTCTGCAGGCTATACAAGCATGG - Intergenic
933187781 2:79298126-79298148 TTCTGTAGGCTTCATAGGCATGG + Intronic
933330266 2:80884648-80884670 TTCTGCAGGCTGTACAAGTATGG + Intergenic
933336635 2:80967411-80967433 CTCTGCAGGCTGTACAAGCATGG + Intergenic
933610902 2:84434116-84434138 TTCTGCAGGCTATACATGCATGG - Intronic
933640015 2:84748850-84748872 TTCTGCAAGCTGTACAAGTATGG + Intronic
933905940 2:86892488-86892510 TTCTGTACACTTTAGAAGGAAGG + Intergenic
934012723 2:87841340-87841362 TTCTGCAGGTTGTACAAGCATGG - Intergenic
934702077 2:96450587-96450609 TTCTGCAGGCTGTACAAGCATGG + Intergenic
934898861 2:98141316-98141338 TTCTGCAGGCTGTGCAAGCAGGG + Intronic
934944288 2:98526736-98526758 TTCTGCAGGCTATACAAGCATGG + Intronic
935241390 2:101181324-101181346 TTCTGCAAGCTGTACCAGCATGG + Intronic
935501986 2:103852669-103852691 TCCAGTAAGCTTTGCAAGCAAGG + Intergenic
935715936 2:105938945-105938967 TTCTGCAGGCTGTACAAGCATGG - Intergenic
936038810 2:109133165-109133187 TTCTGTGAGGGTTACAAGGAAGG + Intronic
936237257 2:110753275-110753297 TTCTGCAGGCTGTACAAGCATGG - Intronic
936256063 2:110913695-110913717 TTCTGCAGGCTATACAAGCATGG + Intronic
936341845 2:111640667-111640689 TGCTGAAAGCTTTACATGCCTGG + Intergenic
936469898 2:112789798-112789820 TTCTGCAGGCTGTACAAGCATGG - Intergenic
936562944 2:113557591-113557613 TTCTGAAGGCTGTACAAGCCTGG + Intergenic
936835991 2:116710153-116710175 TTCTGCAGGCTGTACAAGCATGG + Intergenic
936842665 2:116791563-116791585 TTCTGCATGTTTTACAAGAAAGG + Intergenic
936857428 2:116976494-116976516 TTCTGTAAAGTTTACATGCAGGG - Intergenic
937462629 2:122102648-122102670 TTCTGCAAGCTGTAAAATCATGG + Intergenic
938592307 2:132751370-132751392 TTCTGCAGGCCGTACAAGCATGG - Intronic
938905814 2:135835001-135835023 TTCTTTAAGATTTTAAAGCATGG - Intronic
938941573 2:136174274-136174296 TACTGTAAATTTTACATGCAAGG + Intergenic
939023654 2:136986496-136986518 TTCTGCAGGCTGTACAAGCATGG - Intronic
939023935 2:136989535-136989557 TTCTGCAGGCTATACAAGCATGG - Intronic
939196059 2:138974107-138974129 TTCTGCAGGCTGTACAAGCATGG + Intergenic
939231204 2:139428235-139428257 TTCTATAGGCTGTACAAGCATGG - Intergenic
939440857 2:142247527-142247549 TTTTATACGCTGTACAAGCATGG - Intergenic
939678526 2:145102196-145102218 TTCTGCAGGCTGTACAAGCATGG + Intergenic
939718069 2:145610380-145610402 TTCTCTCAGCTTTATAAGGAGGG - Intergenic
939833581 2:147101515-147101537 TTCTACAGGCTGTACAAGCATGG + Intergenic
939929079 2:148209670-148209692 TTCTGCAGGCTGTATAAGCATGG + Intronic
940163830 2:150745312-150745334 TTCTATAAACTTTAAAATCAGGG - Intergenic
940194682 2:151080568-151080590 TTCTGCAGGCTGTACAAGCATGG + Intergenic
940416453 2:153428228-153428250 TTCTGCAGGCTATACTAGCATGG + Intergenic
940422288 2:153493946-153493968 TTCTATGGGCTATACAAGCACGG + Intergenic
941192633 2:162404696-162404718 TTCTGCAGGCTGTACAAGCATGG - Intronic
941370914 2:164662884-164662906 TTCTGCAGGCTGTACAAGCATGG - Intronic
941547550 2:166871278-166871300 TTCTGCAGGCTGTACAAACATGG - Intergenic
941888261 2:170551976-170551998 TTCAGGAAGCTTTAAAATCATGG - Intronic
941922885 2:170869815-170869837 TTCTGCAGGCTATACAAGCATGG - Intergenic
941984449 2:171496608-171496630 TTCTGCAGGCTGTACAAGCATGG + Intergenic
942347330 2:175017086-175017108 TTCTGCAAGCTATACAAGCATGG - Intergenic
942364748 2:175212995-175213017 TTCTGCAGGCTGTACAAGCATGG - Intergenic
942486300 2:176443241-176443263 TTCTGCAGGCTGCACAAGCATGG - Intergenic
942503419 2:176616510-176616532 TTCTGCAGGCTGTACAAGCATGG + Intergenic
942534209 2:176946174-176946196 TTCTGCAGGCTGTACAAGCATGG - Intergenic
942812411 2:180014471-180014493 TTCTGCAGGCTGTATAAGCAGGG - Intergenic
942995448 2:182254765-182254787 TTCTGTTAGTGTCACAAGCAGGG - Intronic
943275251 2:185858784-185858806 TTCTGCAGGCTATACATGCATGG + Intergenic
943402675 2:187435176-187435198 TTCTGCAGGCTGTATAAGCATGG + Intronic
943483285 2:188448971-188448993 TTCTGCAGGCTGTCCAAGCATGG - Intronic
943511668 2:188834433-188834455 TCCTGCAGGCTGTACAAGCATGG - Intergenic
943580328 2:189676013-189676035 TTCTGCAGGCTGTACAAGCATGG - Exonic
944227163 2:197359671-197359693 TTCTGCAGGCTGTACAAGCATGG + Intergenic
944613736 2:201438577-201438599 TCCTCTGAGCTTTACTAGCAAGG + Intronic
945237015 2:207640368-207640390 TTCTGCAGGCTGTATAAGCATGG - Intergenic
945237793 2:207648379-207648401 TTCTGCAGGCTGTACAAGCAGGG - Intergenic
945304318 2:208244263-208244285 TTCTGCAGGCTGTACAAGCCTGG - Intronic
945679117 2:212891630-212891652 TTCTGCAGGCTGTACAAGCATGG - Intergenic
945893075 2:215450837-215450859 TTCTGCAGGCTGTACAAGCATGG - Intergenic
946515183 2:220403718-220403740 TTCTGCAGGCTATACAAGCCTGG - Intergenic
946764718 2:223029979-223030001 TTCTGCAAGCTGTACAAGCATGG + Intergenic
946809287 2:223506165-223506187 TTCTGCAGACTGTACAAGCATGG - Intergenic
946819359 2:223614339-223614361 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
946897271 2:224337114-224337136 TTCTGCAGGCTGTACAGGCATGG - Intergenic
946941382 2:224773460-224773482 TTCTGCATGCTTTTCATGCATGG + Intronic
947081597 2:226403640-226403662 TTCTGTAAGCATTTCCAGGATGG - Intergenic
947091894 2:226521319-226521341 TTCTGCAGGCTATACAAGCCTGG + Intergenic
947183188 2:227431080-227431102 TTCTATAGGCTGTACAAACATGG + Intergenic
947183502 2:227433486-227433508 TTCTGCAGGCTGTACAAACATGG + Intergenic
947197371 2:227582438-227582460 TTCTGTAGGCTATACAAGCATGG - Intergenic
947197518 2:227583667-227583689 TTCTGCAGGCTGTACAAGCATGG + Intergenic
947782831 2:232785038-232785060 TTCTGCAGACTATACAAGCATGG - Intronic
947895175 2:233664489-233664511 TTTTGCAGGCTGTACAAGCATGG + Intronic
947923448 2:233899984-233900006 TCCTGCAAGCTTCAGAAGCAAGG - Intergenic
948030715 2:234815200-234815222 TTCTGCAGGCTGTACAAGGATGG - Intergenic
948034870 2:234850282-234850304 TTCTGCAGGCTGAACAAGCATGG + Intergenic
948046295 2:234947956-234947978 TTCTGTGGGCTGTACAAGCATGG + Intergenic
1169412216 20:5381450-5381472 TTCTGTAGGCTGTGCAAGCATGG + Intergenic
1169467242 20:5852122-5852144 TTCTGCAGGCTGTACAAGCATGG - Intronic
1169617478 20:7465153-7465175 TTATGCAGGCTGTACAAGCAAGG + Intergenic
1169621266 20:7509031-7509053 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1169703651 20:8477587-8477609 TTCTGCAGGCTGTACAAGCTTGG + Intronic
1169763926 20:9128300-9128322 TTCTGCAGGTTGTACAAGCATGG - Intronic
1170717680 20:18846106-18846128 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1170721277 20:18881384-18881406 TTCTGCAGGCCATACAAGCATGG - Intergenic
1171353370 20:24522735-24522757 TTCTGTAGGCTGTACAAGCATGG + Intronic
1171354526 20:24533942-24533964 TTCTGCAGGCTGTACAGGCACGG + Intronic
1172017752 20:31888686-31888708 TTCTACAGGCTGTACAAGCATGG + Intronic
1172818564 20:37711163-37711185 GTCTGTAAGCTTCTCAAGCAAGG - Intronic
1173030453 20:39353788-39353810 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1173314848 20:41933825-41933847 TTCTACAGGCTGTACAAGCATGG - Intergenic
1173734831 20:45352527-45352549 TTCTGCAGGCTATACAAGCATGG - Intergenic
1173912255 20:46679060-46679082 TTCTGCAGGCTGTACAAGCATGG - Intronic
1173958029 20:47049698-47049720 TCCTGCAGGCTGTACAAGCATGG - Intronic
1174060507 20:47829656-47829678 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1174071391 20:47901714-47901736 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1174152662 20:48496947-48496969 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1174444070 20:50578824-50578846 TTCTGCAGGCTGTACAAGCATGG + Intronic
1175649146 20:60702136-60702158 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1175852805 20:62102869-62102891 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1176552789 21:8236246-8236268 CTCTGGAAGGTTTCCAAGCAGGG - Intergenic
1176571687 21:8418649-8418671 CTCTGGAAGGTTTCCAAGCAGGG - Intergenic
1176579598 21:8463211-8463233 CTCTGGAAGGTTTCCAAGCAGGG - Intergenic
1176934731 21:14853417-14853439 TTCTGTAGGTTGTGCAAGCATGG - Intergenic
1177252210 21:18608234-18608256 TTCTGAAAGCATTATAAGAAAGG - Intergenic
1177470416 21:21553848-21553870 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1177642460 21:23861383-23861405 TTCTGCAAACTGTACAAGAAGGG - Intergenic
1177773796 21:25545876-25545898 TTCTGCAGGCTGTACAAGCGTGG + Intergenic
1177789700 21:25709682-25709704 TTCTGCAAGCTGTACAATCCTGG + Intronic
1177882084 21:26706214-26706236 TTCTGTAGGCTGTATAAGCATGG + Intergenic
1177966830 21:27738141-27738163 TTCTGCAGGCTATACATGCATGG + Intergenic
1178052475 21:28763266-28763288 TTCTGCATGCTGTACAAGCATGG + Intergenic
1178110701 21:29367223-29367245 TTCTGCAAGTTGTACAGGCACGG - Intronic
1178261080 21:31100284-31100306 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1178326266 21:31647720-31647742 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1178766037 21:35451806-35451828 TTCTGCAGGCTGTGCAAGCATGG + Intronic
1179190436 21:39118169-39118191 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1179378615 21:40877708-40877730 TTCTGCAGGCTATACAAACAGGG + Intergenic
1179630644 21:42676159-42676181 TTCTGCAGGCTGTATAAGCATGG - Intronic
1179776336 21:43665828-43665850 CTCTGCAGGCTGTACAAGCATGG - Intronic
1179877174 21:44274937-44274959 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1180152367 21:45956734-45956756 TTTTGTAGGCTACACAAGCATGG + Intergenic
1180499259 22:15917988-15918010 TAATGCAAGCTGTACAAGCATGG + Intergenic
1181812536 22:25412641-25412663 TTCTGCAAGCTGTACAAACATGG + Intergenic
1182290604 22:29276150-29276172 GTCTATAAGATTTACAAGGAGGG - Intronic
1182803174 22:33048698-33048720 TTCTGCAGGCTGTACAAGCATGG - Intronic
1182866629 22:33610038-33610060 TTCTGCAGGCTGTACAAGCATGG - Intronic
1182866923 22:33612030-33612052 TTCTGCAGGCTGCACAAGCATGG - Intronic
1182882191 22:33743174-33743196 TTGTGTAGGCTATACAGGCATGG - Intronic
1182908327 22:33957743-33957765 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1182960672 22:34471662-34471684 TTCTGTAAACATTATAAACATGG - Intergenic
1183488131 22:38100700-38100722 TTCTGCAAACTGTACAAGCATGG - Intronic
1183659723 22:39212100-39212122 TTCTGCAGGCTGTACCAGCATGG - Intergenic
1184063068 22:42096736-42096758 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1184319335 22:43727822-43727844 TTCTGCAGGCTGTACAAGCATGG + Intronic
1184498739 22:44859469-44859491 TTCTACAGGCTGTACAAGCATGG - Intronic
1184899625 22:47436861-47436883 CTCTGCAAGCTGTACAGGCATGG - Intergenic
1184946088 22:47805161-47805183 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1203257766 22_KI270733v1_random:152646-152668 CTCTGGAAGGTTTCCAAGCAGGG - Intergenic
949108101 3:224647-224669 TTCTTCAAGCTGTACAAGCATGG - Intronic
949366616 3:3288551-3288573 TTCTGCAGGCTGTACAAGCATGG - Intergenic
949706058 3:6818188-6818210 TTCTGCAGGCTGTACAAGTATGG + Intronic
949797274 3:7864587-7864609 TTCTACAGGCTGTACAAGCATGG - Intergenic
950280283 3:11701372-11701394 TGCTGTAGGCTGTACAAGCATGG - Intronic
950706009 3:14782233-14782255 TTCTACAGGCTGTACAAGCATGG - Intergenic
951241108 3:20287342-20287364 TTCTGCAGGCTGTACAAGCTTGG + Intergenic
951949006 3:28177739-28177761 TTCTGCAAGTTGTACAAGCATGG + Intergenic
952010632 3:28897040-28897062 TTCTGCAGGCTGTACAAGCATGG + Intergenic
952110932 3:30123238-30123260 TTCTGCAGGCTGTACAAGCATGG - Intergenic
952552388 3:34494239-34494261 TGCTGAGAGCTTTATAAGCAGGG + Intergenic
952670519 3:35961822-35961844 TTCTGCAGGCTGTACAAGCATGG + Intergenic
952739314 3:36720309-36720331 TTCTGCAGGCTGTACAAGCATGG - Intronic
953481304 3:43254603-43254625 TTCTGTAAGCTGTAAAAGCATGG - Intergenic
953598621 3:44340924-44340946 TCCTGTAAGCTCTTCAAGAATGG - Intronic
954504061 3:51051743-51051765 TTCTGCAGACTGTACAAGCAAGG + Intronic
954633074 3:52057274-52057296 TTAAGAAAGCTTTACAAGCGGGG + Intergenic
955167161 3:56526068-56526090 TTCTGCAGGCTGTACAAGCATGG - Intergenic
955574512 3:60345490-60345512 CTCTGTGAGCTTGAAAAGCAAGG - Intronic
955577365 3:60380391-60380413 TTCTGCAGGGTGTACAAGCATGG - Intronic
955636513 3:61036080-61036102 TTCTGGAGGCTGTACGAGCATGG + Intronic
955664813 3:61338845-61338867 TTCTGCAGGCTTTACAATCATGG - Intergenic
956148306 3:66214328-66214350 TTCTGCAGGCTGTACAAGTATGG - Intronic
956930039 3:74033330-74033352 TTCTACAGGCTGTACAAGCATGG + Intergenic
957011629 3:75012233-75012255 TTCTGCAGGCTGTACAAGAATGG - Intergenic
957576359 3:82013784-82013806 TTCTGCAGGCTGTACAAGCATGG - Intergenic
958042840 3:88246705-88246727 TTCTGCAGGCTGTACAAGCATGG - Intergenic
958792291 3:98665570-98665592 TACTGAAAACTTTAAAAGCATGG - Intergenic
959227185 3:103600689-103600711 GTCTGCAAGCTTGAGAAGCAAGG + Intergenic
959434618 3:106298822-106298844 TTCTGCAGGCTGTACTAGCATGG - Intergenic
959746555 3:109782022-109782044 TTCTGTAGGCTGTACGGGCATGG + Intergenic
960250143 3:115442828-115442850 TTCTGCAGGCTGTACAAGTATGG + Intergenic
960442173 3:117702285-117702307 TTCTTCAAGCTGTACAAACATGG - Intergenic
960521495 3:118660456-118660478 TTCTGCAGGCTGTACAAGCATGG - Intergenic
960591859 3:119374408-119374430 TTCTGCAGGCTGTCCAAGCATGG - Intronic
960636892 3:119793155-119793177 TTCTGAAGGCTGTACAAGCTTGG - Intronic
961241823 3:125417776-125417798 ATCTGTATGCTGAACAAGCATGG + Intergenic
961525316 3:127493140-127493162 TTCTGCAGGCTATACAAGCATGG + Intergenic
961656746 3:128446707-128446729 TTCTGCAGGCTGTACAAGCATGG - Intergenic
961672247 3:128541768-128541790 TTCTGCAGGCTGTACAAGCATGG - Intergenic
961765028 3:129203343-129203365 TTCTGTAGGCTGTACAAGCATGG - Intergenic
963849338 3:150194603-150194625 TTCTGCAGGCTATACCAGCATGG + Intergenic
964092235 3:152891427-152891449 TTCTGCAGGCTGTACAAGCATGG + Intergenic
964298610 3:155262195-155262217 GTTTGAAAGCTTTAGAAGCAAGG + Intergenic
964561057 3:157997032-157997054 TTCTGCAGGCTATACAAGCAGGG - Intergenic
964831826 3:160892203-160892225 TTCTGTAGGCTATACAGGCATGG + Intronic
964849844 3:161083384-161083406 TACTGTAGACTTTACAAACATGG + Intergenic
964903246 3:161686483-161686505 TTCTGCAGGCTGTACAAGCATGG - Intergenic
965781814 3:172294331-172294353 TTCTGCAGGCTGTACAAGCATGG + Intronic
965865294 3:173198409-173198431 TTCTGCAGGATATACAAGCATGG + Intergenic
966296199 3:178426822-178426844 CTCTGTAAGCATTTCATGCAGGG + Intronic
966296778 3:178432830-178432852 CTCTGCAAGCTATACAAGCATGG - Intronic
966675254 3:182579312-182579334 TTCTGCAGGCTGTACAAGCATGG + Intergenic
967186934 3:186952068-186952090 TTCTGCAGGCTGTACAGGCATGG + Intronic
967806129 3:193715993-193716015 TTCTGTAGGCTGTACAAACATGG - Intergenic
968780925 4:2580779-2580801 TTCTGTAGGCTATACAAGCATGG - Intronic
968981058 4:3849711-3849733 TTCTGTGGGCTGTACAAGCATGG + Intergenic
969082435 4:4629260-4629282 TTCTGCAGGCTGTACAGGCACGG - Intergenic
969543518 4:7808927-7808949 TTCTGCAGGCTATACAAGTATGG - Intronic
969553006 4:7884227-7884249 TTCTGCAGGCTTTACAAGCATGG - Intronic
970015463 4:11507725-11507747 TTCTGCAGGCTGTACAAGCATGG + Intergenic
970062384 4:12049801-12049823 TTCTGCAAGCTGTACAAGTATGG - Intergenic
970075000 4:12208374-12208396 TTCTGTAGGATGTAAAAGCATGG + Intergenic
970249635 4:14100686-14100708 TTCTGCAGGCTGTACAAGCATGG + Intergenic
970298530 4:14657554-14657576 TTCTGCAGGCTCTTCAAGCAGGG - Intergenic
970791290 4:19860896-19860918 TTCTGCAGGTTGTACAAGCATGG - Intergenic
971342000 4:25779309-25779331 TTCTGATAGCTTTAAAACCAGGG + Intronic
971376229 4:26057889-26057911 TTCTGCAGGCTGTACAAGCATGG + Intergenic
971455914 4:26843763-26843785 TTCTGCAGGCTGTACAAGCAGGG + Intergenic
971475539 4:27068469-27068491 TTTTTTAAGCTTTTCACGCAAGG - Intergenic
971976019 4:33687972-33687994 TTCTGCAGGCTATGCAAGCATGG - Intergenic
972161933 4:36237673-36237695 TTCTGCAGGCTGTACAAGCATGG - Intronic
972211938 4:36848901-36848923 TTCTGCAGGCTGTAGAAGCATGG - Intergenic
972341032 4:38152724-38152746 TTCTGCAGGCTGTACAAACATGG + Intergenic
972955271 4:44381868-44381890 TTCTGTAGGCTGGACAAGCCTGG - Intronic
973009996 4:45060979-45061001 TTCTGTAGGCTGTGCAAGCATGG - Intergenic
973614502 4:52665201-52665223 TTCTGCAGGCTACACAAGCATGG + Intergenic
973665153 4:53151789-53151811 TTCTGCAGGTTGTACAAGCATGG + Intronic
973665439 4:53154244-53154266 TTCTGCAGGCTGTACAAGCATGG + Intronic
973665443 4:53154297-53154319 CTCAGGAAGCTTTACAATCATGG + Intronic
973979093 4:56291760-56291782 TTCTGCAGGCTATATAAGCATGG - Intronic
974297941 4:60027849-60027871 TTCTGCAGGCTGTACAAGCATGG + Intergenic
974325528 4:60409322-60409344 TTCTGCAGGCTGTACAAGCATGG - Intergenic
974441602 4:61925510-61925532 TTCTGCAGGCTCTACAAGCATGG + Intronic
974488589 4:62534901-62534923 TTCTGCAGGCTCTACAAGCATGG + Intergenic
974528148 4:63072481-63072503 TTGTGGAAGCTTTATAATCAGGG + Intergenic
974580555 4:63794977-63794999 TTCTGCAGGCTGTACAAGCATGG - Intergenic
975673978 4:76808809-76808831 TTCTGCAGGCTGTACGAGCATGG + Intergenic
976013098 4:80516396-80516418 TTCTGTGGGCTATACAAGGATGG + Intronic
976015419 4:80546810-80546832 TTCTGCAGGCTGTACAAACATGG - Intronic
976133602 4:81911221-81911243 TTTTGCAGGCTGTACAAGCATGG - Intronic
976411692 4:84720702-84720724 TTCTACAAGCTGTACAAGCATGG - Intronic
976589459 4:86834765-86834787 TTCTGCAGGCTGTACAAGCATGG + Intronic
977154962 4:93560314-93560336 TTCTGCAGGCTATACAAACATGG + Intronic
977325177 4:95565549-95565571 TTCTGCAGGCTGTACAAGCATGG - Intergenic
977499374 4:97820657-97820679 TTCTGCAAGCTGCAGAAGCATGG + Intronic
977612674 4:99052402-99052424 TTCTGCAGGCTATACAAGCATGG + Intronic
977720015 4:100229093-100229115 TTCTGCCAGCTGTACAAGCATGG - Intergenic
977902492 4:102438241-102438263 TTCTGCAGGCTGTACAAGCATGG - Intergenic
978100798 4:104839061-104839083 TTCTACAGGCTGTACAAGCATGG - Intergenic
978203997 4:106057698-106057720 TTCTGAAAGCTTTACAGAGAGGG - Intronic
978408757 4:108406717-108406739 TTCTGCAGGCTGTATAAGCATGG + Intergenic
978712442 4:111800688-111800710 TTCTGCAGGCTGTACCAGCATGG + Intergenic
979234552 4:118385192-118385214 TTCTGCGGGCTGTACAAGCATGG - Intergenic
980009221 4:127577918-127577940 TTCTGCAGGCTGTACAAACATGG + Intergenic
980219524 4:129897966-129897988 TTCTGCAGGCTGTATAAGCATGG + Intergenic
980613884 4:135193882-135193904 TTCTGCAGGCTGTACAAGCATGG - Intergenic
980614110 4:135195436-135195458 TTCTGCAGGCTGTACAAGCATGG - Intergenic
980702900 4:136455549-136455571 GTCTGTAAGCTTGAGGAGCAAGG - Intergenic
981052509 4:140323346-140323368 TTCTGCAGGCTGTACAAGCATGG - Intronic
981055040 4:140351678-140351700 TTCTGAAAGCTTTTCAAACCCGG - Intronic
981262714 4:142741215-142741237 TTCTGCAGGCTATACAAGAATGG + Intronic
981689128 4:147486961-147486983 CTCTGTAGGCTGTACATGCATGG + Intronic
981719483 4:147787162-147787184 TGCTGGAGGCTTTAGAAGCAAGG + Intronic
981834431 4:149039042-149039064 GTCTGCAAGCTTGAGAAGCAAGG - Intergenic
982041858 4:151405525-151405547 TTCTGCAAGCTGTACAAGCATGG + Intergenic
982162917 4:152587687-152587709 TTCTGCAGGCTGTAAAAGCATGG - Intergenic
982178032 4:152725098-152725120 TTCTGCAGGCTGTACAAGCATGG + Intronic
982282560 4:153699973-153699995 TTCTGCAGGCTGTACAAGCATGG + Intergenic
982386114 4:154804126-154804148 TTCTGTAAGCTTTACAAGCATGG - Intronic
982621347 4:157710051-157710073 TTCTGCAGGCTGTCCAAGCATGG + Intergenic
982775897 4:159441028-159441050 TTCTGCAGGCTGTACAAGCATGG - Intergenic
983165164 4:164467373-164467395 TTCTGCAGGCTGTACAAGCATGG + Intergenic
983256127 4:165402680-165402702 TTCTGCAGGCTGTACAAGCATGG - Intronic
983468220 4:168122578-168122600 TTCTGCAGGCTGTACAAGCATGG + Intronic
983698277 4:170559578-170559600 TTCTGCAGGCTGTACAAACATGG - Intergenic
983768870 4:171522459-171522481 TGCTGTAAACAGTACAAGCAAGG + Intergenic
983914632 4:173279155-173279177 TTCTGCAGGCTGTACAAGCATGG + Intronic
984198438 4:176688480-176688502 TTCTGGAGGCTTTACAAGATGGG - Intronic
984367699 4:178820345-178820367 TTCTGCAGGCTGTACAAGCATGG + Intergenic
984438717 4:179737903-179737925 TTATGAAAGATTTAAAAGCAAGG - Intergenic
984591898 4:181626445-181626467 TTCTGCAGGCTGCACAAGCATGG + Intergenic
984744032 4:183196166-183196188 TTCTGCAGGATATACAAGCACGG - Intronic
985008692 4:185560320-185560342 TTCCGCAAGCTGTACAAGCATGG - Intergenic
985045223 4:185933878-185933900 CTCTGTAATCTTTTCAAGAAGGG - Intronic
985235707 4:187871584-187871606 TTCTGCAGGCTGTACAAGCATGG - Intergenic
985365766 4:189231014-189231036 TTCTGTTTGCTGTACAAGCATGG + Intergenic
985636939 5:1040423-1040445 TTCTGCAGGCTGTACAAGCATGG - Intergenic
985809424 5:2072107-2072129 TTCTGCAGGCTGTACAAGCATGG - Intergenic
985953764 5:3244476-3244498 TTCTGCAGGCTGTAGAAGCACGG + Intergenic
986138707 5:5008665-5008687 TTCTGCAGGCTGTACAAGCTTGG - Intergenic
986345985 5:6835679-6835701 TTCTGCAGGCTGTACAAGCCGGG - Intergenic
986399623 5:7368324-7368346 TTCTGAAGGTTGTACAAGCATGG - Intergenic
986590848 5:9367997-9368019 TTCTGCAGGCTGTACAAGCATGG - Intronic
986648179 5:9938900-9938922 TTCTGCAGACTGTACAAGCATGG + Intergenic
987144413 5:14978457-14978479 TTCTGCAGGCTGTACAAGCATGG + Intergenic
987214513 5:15719697-15719719 TTCTAAAATCTTTACAAGGACGG + Intronic
987220377 5:15784774-15784796 TTCTGCAGGCTGTACAAGCATGG - Intronic
988161235 5:27520347-27520369 TTCTGCAAGCTTGAGGAGCAAGG + Intergenic
988549333 5:32185975-32185997 TTCTGCAGGCTGTACAAGCATGG - Intergenic
988833123 5:35006383-35006405 TTCTACAGGCTGTACAAGCATGG + Intronic
988924656 5:35977653-35977675 TTCTGCAGGCTGTACAAGCATGG - Intronic
989042173 5:37240400-37240422 TTCTGCAGGCTGTGCAAGCATGG + Intronic
989111305 5:37908717-37908739 TTCTGCAGGCTGTACAAGCATGG - Intergenic
989307992 5:39979803-39979825 TTCTGCAGGCTGTACTAGCATGG - Intergenic
989327709 5:40218948-40218970 TACTGTAGGCTGTATAAGCATGG - Intergenic
989393396 5:40925689-40925711 TTCTGTAGGCTGTACAAGCATGG + Intronic
989448085 5:41554464-41554486 TTCTGCAGGCCATACAAGCATGG - Intergenic
989460476 5:41692216-41692238 ATCTGCAGGCTGTACAAGCATGG - Intergenic
989545736 5:42671173-42671195 TTCTGCAGCCTGTACAAGCATGG + Intronic
990130382 5:52574909-52574931 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
990619089 5:57540539-57540561 TTCTGCAGGCTGTACAAGCATGG - Intergenic
990785089 5:59409686-59409708 TTCTGCAGGATGTACAAGCATGG - Intronic
990989361 5:61670134-61670156 TTCTGCAGGCTATACAAGCATGG + Intronic
991008224 5:61853367-61853389 TTCTGCAGGCTGTACAAGCATGG + Intergenic
991085645 5:62646391-62646413 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
991259745 5:64653764-64653786 TTCTTCAGGCTGTACAAGCATGG - Intergenic
991643643 5:68778960-68778982 TTCTGCAGGCTGTACAAGCATGG + Intergenic
992208330 5:74452635-74452657 TGCTGCAGGCTGTACAAGCATGG - Intergenic
992311794 5:75509353-75509375 TTCTGGAAGCTTTTTAATCAAGG - Intronic
992345947 5:75878880-75878902 TTCTGAAAGCTGTACAAGCATGG + Intergenic
992558042 5:77922340-77922362 TTCTGCAGGCTATACAAGCATGG - Intergenic
992647389 5:78824167-78824189 TTCTGCAGGCTGTACAAGCATGG - Intronic
992780350 5:80121691-80121713 TTCTGCAGGCTGTACAACCATGG + Intronic
992876395 5:81059922-81059944 TTCTGCAGGCTGTACAAGCATGG + Intronic
993198401 5:84781150-84781172 TTCTGTAGGCTGTACAAGCATGG + Intergenic
993248671 5:85486296-85486318 TTATGAAAACTTTAAAAGCATGG + Intergenic
993468863 5:88282082-88282104 TTCTGCAGGCTGTAGAAGCACGG - Intergenic
993597103 5:89870933-89870955 TTCTGTAAGCTAGAAGAGCAGGG + Intergenic
994138738 5:96319027-96319049 TTCTGCAGGCTGTAGAAGCATGG + Intergenic
994500068 5:100564156-100564178 TTCTGCAGACTATACAAGCATGG - Intronic
995204652 5:109465834-109465856 TTCTTTAAGCCTTACAACTAAGG - Intergenic
995648929 5:114345716-114345738 TTCTGCAGGCTATACAAGCATGG + Intergenic
995761253 5:115564610-115564632 TTCTGCAGGCTGTACAAGCATGG - Intergenic
995761519 5:115566653-115566675 TTCTGCAGGTTGTACAAGCATGG - Intergenic
995951712 5:117722104-117722126 TTCGGTAGGCTGTGCAAGCATGG + Intergenic
996004804 5:118406824-118406846 TTCTGCAAGCTGTATATGCATGG + Intergenic
996090266 5:119344159-119344181 TTCTGCAGGCTATGCAAGCATGG + Intronic
996217679 5:120888937-120888959 TTCTGAAGGCTGTACAAGCATGG - Intergenic
996266038 5:121541657-121541679 TTCTGCAAGTTTTACAACCTAGG - Intergenic
997850848 5:137331524-137331546 TTCTGCAGGCTGTATAAGCATGG + Intronic
998018283 5:138750424-138750446 TTCTGCAGGCTGTATAAGCAAGG + Intronic
998072105 5:139205959-139205981 TTCTGCAGGCTGTACAAGCATGG - Intronic
998217664 5:140249632-140249654 GTCTGCAGGCTATACAAGCATGG + Intronic
999107662 5:149087795-149087817 TTCTGCAGGCTGTACAAGCATGG - Intergenic
999117377 5:149175730-149175752 TGCAGTGAGCTTCACAAGCAAGG - Intronic
999648984 5:153747143-153747165 TTCTGTGGGCTATACAAGCATGG + Intronic
999716940 5:154368813-154368835 GTCTATAAGTTTTTCAAGCAAGG + Intronic
999900856 5:156085525-156085547 TTCTGCAGGCTGTACATGCATGG - Intronic
999908300 5:156167794-156167816 TTCTACAGGCTGTACAAGCATGG - Intronic
1000101098 5:158017284-158017306 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1000402014 5:160839069-160839091 TTCTGCAGGCTGTACAAGCATGG - Intronic
1000830060 5:166092131-166092153 TTCTGCAGGCTATGCAAGCATGG + Intergenic
1001061843 5:168497565-168497587 TTCTGCAGGCTGTACAAGCATGG + Intronic
1001078542 5:168649363-168649385 TTCTGCAGGCTGTACAATCATGG + Intergenic
1003152809 6:3566790-3566812 TTCTGCAGGCTGTACGAGCATGG - Intergenic
1003439409 6:6125196-6125218 TTCTGCAGGCTATATAAGCATGG - Intergenic
1004148877 6:13095787-13095809 CCCAGTAAGCTTTACAAGCCTGG - Intronic
1004205536 6:13588461-13588483 TTCTGGAAACTTTACAAACCTGG - Exonic
1004455229 6:15785738-15785760 TTCTGCAGGCTATACAAGCATGG - Intergenic
1004478086 6:15992887-15992909 TTCTGCAGGCTCTACAAACATGG - Intergenic
1004700098 6:18070470-18070492 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1004762126 6:18678664-18678686 TTCTGCAGTCTGTACAAGCATGG - Intergenic
1004804206 6:19184215-19184237 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1004882531 6:20023036-20023058 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1005423195 6:25673852-25673874 TTCTGCAGGCTGTACAAGCATGG + Intronic
1005573408 6:27169015-27169037 TTCCGCAGGCTATACAAGCATGG - Intergenic
1005597775 6:27395479-27395501 TTCTGCAGGCTGTAAAAGCATGG - Intronic
1005834428 6:29697066-29697088 TTCTGCAGGCTGTACAATCATGG - Intergenic
1007053752 6:38860260-38860282 TTCTGTAAGCTCTGGAAGCCTGG + Intronic
1007225301 6:40309528-40309550 TTCTGCAGGCTGTACAAGAATGG + Intergenic
1008113286 6:47517242-47517264 TTCTGCAAGCTATACAAGCATGG - Intronic
1008189760 6:48439845-48439867 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1008189861 6:48441412-48441434 TTCTGCAGGCTCTATAAGCATGG + Intergenic
1008247831 6:49200801-49200823 TTCTGTCAGCTGTATATGCAAGG - Intergenic
1008306680 6:49911299-49911321 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1008513148 6:52296063-52296085 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1008652712 6:53579405-53579427 TTCTGCAGGCTGTACAAGCATGG + Intronic
1008691405 6:53983336-53983358 TTCTGCAGGCTGTATAAGCATGG + Intronic
1008830013 6:55747524-55747546 TTCTTTAGGCTATACAAACATGG - Intergenic
1009873346 6:69474986-69475008 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1010266578 6:73874787-73874809 TTCTGTAGGCTGTACAAGCTTGG + Intergenic
1010430093 6:75768881-75768903 TTCTGTAGGATGTAGAAGCATGG + Intronic
1010449313 6:75984956-75984978 TTCTGCAGGCTGTACAAACATGG - Intronic
1010590523 6:77706873-77706895 TTCTATAGGCTGTATAAGCATGG - Intronic
1010939392 6:81897784-81897806 TTCTGTAATCTTCCCTAGCAAGG + Intergenic
1010984446 6:82406919-82406941 TTATGTAGGCTTTTCAAGTAGGG + Intergenic
1010990722 6:82477260-82477282 TTCTGCAGACTGTACAAGCATGG + Intergenic
1011346265 6:86372348-86372370 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1011371229 6:86638843-86638865 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1011781915 6:90799280-90799302 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1011821812 6:91261998-91262020 TTATGCAGGCTGTACAAGCATGG + Intergenic
1011898538 6:92262391-92262413 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1011996789 6:93599589-93599611 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1012124943 6:95417233-95417255 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1012402770 6:98857916-98857938 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1013211443 6:107990480-107990502 TTCTTTAAGTTTTGCATGCAAGG - Intergenic
1013486766 6:110604157-110604179 TTCTGCAGGCCATACAAGCATGG - Intergenic
1013729655 6:113149478-113149500 TTCTGTAGGCTGTATAAGCATGG - Intergenic
1013794307 6:113868415-113868437 ATCTGCAAGCTGTACAACCAAGG - Intergenic
1014051688 6:116962510-116962532 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1014136590 6:117896596-117896618 TCCTGCAGGCTTTATAAGCATGG - Intergenic
1014172855 6:118298127-118298149 TTCTGTAGGCTGTATAAGCATGG - Intronic
1014259662 6:119202011-119202033 TACTGTAAACTTTATAAACATGG + Intronic
1014330649 6:120059778-120059800 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1014587110 6:123212434-123212456 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1014594465 6:123316425-123316447 TTTTGTAAGATTTACATACAAGG - Intronic
1014835339 6:126155113-126155135 TTCTGCAGCCTATACAAGCATGG + Intergenic
1014835557 6:126156614-126156636 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1014858219 6:126429597-126429619 TTCTGCAGGCTGTACATGCATGG - Intergenic
1015027659 6:128556139-128556161 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1015218996 6:130782549-130782571 TTCTGCAGGCTGTACAAACATGG - Intergenic
1015377776 6:132530206-132530228 TTCTGGAAACTTCGCAAGCATGG + Intergenic
1015489858 6:133812714-133812736 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1015804176 6:137091907-137091929 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1016141758 6:140620981-140621003 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1016243609 6:141958752-141958774 TTCCGTATGCTGTACGAGCATGG + Intergenic
1016564271 6:145435086-145435108 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1016594679 6:145786127-145786149 GTCTGCAAGCTTGAGAAGCAAGG + Intergenic
1017121925 6:151032244-151032266 TTCTGAAGGCTGTGCAAGCATGG + Intronic
1017190970 6:151652276-151652298 TTCTGCAGCCTATACAAGCAGGG + Intergenic
1017392527 6:153957317-153957339 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1017410377 6:154161691-154161713 TTCTTTAAGCTTTAGAAGAGGGG - Intronic
1017458283 6:154623455-154623477 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1017553788 6:155541230-155541252 TTCTGAAGGCTGTACAAACATGG - Intergenic
1018161226 6:161044721-161044743 TTCTGTATGCTATACAAGCGTGG + Intronic
1018403696 6:163454033-163454055 TTTTGTATGCTTTCCAAACATGG - Intronic
1019757809 7:2786507-2786529 TTCTGTAAGTTTTGCCAGCTTGG - Intronic
1019940878 7:4289432-4289454 TTCTGTAAACATTAAAAGAAGGG - Intergenic
1020248522 7:6449156-6449178 TTCTGTGAGACTTGCAAGCATGG + Intronic
1020414289 7:7928474-7928496 TTCTGCAGGCTATACAGGCATGG + Intronic
1020502866 7:8944952-8944974 TTCTGCAGGCTGTACAAGGATGG + Intergenic
1020534777 7:9382920-9382942 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1021660018 7:22910430-22910452 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1022293400 7:29025251-29025273 TTCTGTAGGCTATACAAGTATGG + Intronic
1022962466 7:35441519-35441541 GTCTGCAAGCTTAAGAAGCAAGG + Intergenic
1023096422 7:36664775-36664797 TTCTGCAGGCTGTACAAGCATGG + Intronic
1023986142 7:45097615-45097637 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1024034978 7:45500339-45500361 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1024596915 7:50946298-50946320 TTCTGCAGGCTACACAAGCATGG + Intergenic
1025234427 7:57224367-57224389 TTCTGCAGGCTGTACAGGCATGG - Intergenic
1025242146 7:57286004-57286026 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1025630687 7:63270030-63270052 TTCTGTAGGTCTGACAAGCATGG + Intergenic
1026058622 7:67006817-67006839 TTCTGCAGGCTCTACAAGCATGG + Intronic
1026451228 7:70531454-70531476 TTCTGCAGGCTTTGCAAGCATGG + Intronic
1026454084 7:70555744-70555766 TTCTGCAAGCCATAAAAGCATGG + Intronic
1026619050 7:71934424-71934446 TTCTGCAGGATGTACAAGCATGG + Intronic
1026719472 7:72818201-72818223 TTCTGCAGACTGTACAAGCATGG - Intronic
1027486483 7:78768148-78768170 TGCTCTTAGCTTTACAAACATGG + Intronic
1027491688 7:78834980-78835002 GTCTGCAGGCTGTACAAGCATGG - Intronic
1027840687 7:83307193-83307215 ATTTATAACCTTTACAAGCAGGG - Intergenic
1027880468 7:83828993-83829015 TTCTGCAGGCTGTACAAGTATGG - Intergenic
1027944936 7:84732724-84732746 TTCTGCAGGCTGTACAAGTATGG + Intergenic
1027947814 7:84772356-84772378 TTGTGTAAGCTTTAAAAGATGGG + Intergenic
1027949738 7:84799664-84799686 TTCTGTAGGCTATACAAGCATGG - Intergenic
1027991555 7:85369419-85369441 TTCTGCAGGCTGTAAAAGCAAGG + Intergenic
1028216506 7:88139964-88139986 TTCTGCAGGCTGTACAAGCATGG + Intronic
1028516066 7:91679541-91679563 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1028933177 7:96437422-96437444 TTCTGCAGGCTATACAAGCATGG + Intergenic
1029065419 7:97843481-97843503 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1029981167 7:104880371-104880393 TTCTGCAGGCTGTACAAGCATGG - Intronic
1030022130 7:105285809-105285831 TTCTGCAGGCTTTACAAGCATGG - Intronic
1030141669 7:106310631-106310653 TTCTGTAAGCTGTACGAACATGG + Intergenic
1030917262 7:115330858-115330880 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1031239258 7:119217337-119217359 GTCTGTAAGCTTGAGGAGCAAGG - Intergenic
1031244251 7:119287843-119287865 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1031382247 7:121101652-121101674 TTCTGCAGGCTGTACAAGTATGG + Intronic
1031394959 7:121262237-121262259 TTCTGCAGGCTATACAAGCATGG - Intronic
1031627732 7:124009627-124009649 TTCTGCAGGCTGTACAGGCATGG - Intergenic
1031742637 7:125454037-125454059 TTCTGAAAACTTCGCAAGCATGG - Intergenic
1032810298 7:135407197-135407219 TTCTGCAGGCTGTACAAGCATGG - Intronic
1033711395 7:143950250-143950272 TTCTGCAGGCTTTACAAACATGG + Intergenic
1034022669 7:147662045-147662067 TTCTTTAAGGTTTGCAAGAAAGG + Intronic
1035006247 7:155663330-155663352 TTCTGTAGGCTGTACAAGTGTGG + Intronic
1035465446 7:159072272-159072294 TTCTGTAAGCTTTAGAGACATGG - Intronic
1036426295 8:8647940-8647962 TTCTGTAGGCTGTACGAGTATGG + Intergenic
1036447454 8:8834323-8834345 TACTGTAGGCTTTATAAACATGG - Intronic
1036749477 8:11434853-11434875 TTCTGGAAGCTGTACACCCAAGG + Exonic
1036927981 8:12925897-12925919 TTCTGTCGGCTGTAAAAGCACGG - Intergenic
1036935424 8:12997435-12997457 TTCTACAGGCTGTACAAGCATGG - Intronic
1037068075 8:14608361-14608383 TTCTGCAGGCTGCACAAGCATGG + Intronic
1037070046 8:14633733-14633755 TTCTGTAAGCTCTACCTGCCTGG - Intronic
1037098685 8:15016762-15016784 TTCTGCAGGCTGTATAAGCATGG + Intronic
1037147654 8:15592653-15592675 TTCTGCAAGCTGTACAAGCATGG - Intronic
1037185859 8:16063023-16063045 TTCTGCAGGCTGTAAAAGCATGG + Intergenic
1037366249 8:18125261-18125283 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1037389388 8:18377629-18377651 TTCTGCAGGCTACACAAGCATGG + Intergenic
1037392443 8:18407949-18407971 TTCTGTAGGCTGAACGAGCATGG - Intergenic
1037605237 8:20432896-20432918 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1037647677 8:20808239-20808261 TTTTGTAGGCTGTACAAGCATGG - Intergenic
1037650445 8:20833289-20833311 TTCTGCAGGCTATACAAGCATGG + Intergenic
1037946253 8:22991322-22991344 ATCTGTGAGCTGTACAAGCCAGG + Intronic
1037970661 8:23169445-23169467 TCCTGTAGGCTGTACAAGCACGG - Intergenic
1038132256 8:24745537-24745559 TTATGTGAGCTTTGAAAGCAGGG - Intergenic
1038412226 8:27367654-27367676 TTCTGCAGGCTGTGCAAGCATGG + Intronic
1038489696 8:27961445-27961467 TTTCGTAGGCTGTACAAGCATGG - Intronic
1038739990 8:30208634-30208656 TTCTGCAGGCTGTACAAGTACGG - Intergenic
1039135798 8:34321499-34321521 TTCTGTAGCATGTACAAGCATGG - Intergenic
1039167518 8:34701299-34701321 TTCTGCAGGCTGTACAAGGATGG - Intergenic
1039185595 8:34912339-34912361 TCCTGCAGGCTGTACAAGCAAGG + Intergenic
1039671443 8:39604712-39604734 TTCTGCAGGCTCTACAGGCATGG - Intronic
1039802974 8:40975858-40975880 TTCTGCATGCTGTACAAGCATGG + Intergenic
1039948410 8:42149616-42149638 TTCTGTAGGCTATGCAAGCGTGG - Intergenic
1039976443 8:42370382-42370404 TTCTTTAAACTTTAAAAGCATGG - Intronic
1040365285 8:46709086-46709108 TTCTGCAGGCTGTACGAGCATGG - Intergenic
1040699596 8:50045257-50045279 TTCTGCAGGTTGTACAAGCATGG + Intronic
1040984789 8:53281554-53281576 TTCTGCAGGCTGTACAAGTATGG - Intergenic
1041185658 8:55298404-55298426 CTCTGCAGGCTCTACAAGCATGG + Intronic
1041265616 8:56061288-56061310 TTCTGCAGGCTATACCAGCATGG - Intergenic
1041483904 8:58353172-58353194 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1041499477 8:58524483-58524505 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1041598815 8:59690650-59690672 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1041869531 8:62617147-62617169 TTCTGCAGGCTGTAGAAGCATGG - Intronic
1041872589 8:62651944-62651966 TTCTGCAGGCTGTACAAGCATGG - Intronic
1042030576 8:64471531-64471553 TTCTTCAAGCTGCACAAGCATGG + Intergenic
1042033718 8:64506973-64506995 TTCTGCAGACTATACAAGCATGG - Intergenic
1043307768 8:78818362-78818384 GTCTGAAAGCCTTACAACCAGGG + Intergenic
1043539446 8:81243131-81243153 GTCTGTAAGCTTGAGGAGCAAGG + Intergenic
1043617075 8:82138975-82138997 TTCTGAAGGCTGTACAAGCATGG - Intergenic
1043639637 8:82435614-82435636 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1043890267 8:85645902-85645924 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043891882 8:85658092-85658114 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043894222 8:85724605-85724627 TTCTCTCATCTTTCCAAGCAAGG + Intergenic
1043894578 8:85727690-85727712 TTCTCTCATCTTTCCAAGCAAGG + Intergenic
1043894934 8:85730775-85730797 TTCTCTCATCTTTCCAAGCAAGG + Intergenic
1043895290 8:85733860-85733882 TTCTCTCATCTTTCCAAGCAAGG + Intergenic
1043897386 8:85747948-85747970 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043897742 8:85751036-85751058 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043898098 8:85754121-85754143 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043899712 8:85766316-85766338 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043901319 8:85778509-85778531 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043901674 8:85781594-85781616 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043903284 8:85793784-85793806 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043904895 8:85805977-85805999 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043906506 8:85818168-85818190 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1044040270 8:87358109-87358131 TTCTGCAAGTTGTACAAGCATGG - Intronic
1044130013 8:88510001-88510023 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1044193834 8:89351796-89351818 TTCTGTAGGCTGTTCAAGCATGG + Intergenic
1044351755 8:91174797-91174819 TGCTGCAAGGTTTACAAGTATGG + Intronic
1044506844 8:93030483-93030505 TTCTGCAGGCTGTACGAGCATGG - Intergenic
1045097286 8:98811016-98811038 TTCTGCAGGTTGTACAAGCATGG - Intronic
1045158253 8:99504289-99504311 TTCTGCAGGCTGTACAAGCATGG - Intronic
1045417527 8:101982150-101982172 TTCTGAAGGGTGTACAAGCATGG - Intronic
1045437137 8:102174654-102174676 TTCTACAGGCTGTACAAGCATGG + Intergenic
1045536274 8:103031377-103031399 TTCTGTAGGCTGTGCAAGCATGG + Intronic
1046110776 8:109721453-109721475 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1046243433 8:111528380-111528402 TTCTGGAGGTTGTACAAGCATGG + Intergenic
1046321455 8:112582319-112582341 TTCTGCAGGCTCTACAAACATGG - Intronic
1046451868 8:114403065-114403087 TTCTGCAGGCTGAACAAGCATGG - Intergenic
1046588999 8:116182831-116182853 TTCTGCAGACTATACAAGCATGG - Intergenic
1046685314 8:117219664-117219686 TTCTATAGGCTGTACCAGCATGG + Intergenic
1047519143 8:125581036-125581058 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1047997590 8:130351519-130351541 TTCTGCAGGCTGTACAAGCATGG + Intronic
1048190071 8:132280315-132280337 TTCTGCAAGCTGTACAAGCATGG + Intronic
1048265008 8:132978104-132978126 TTCTGCAGGCTGTGCAAGCATGG + Intronic
1048425027 8:134315186-134315208 TTCTGAGAACTATACAAGCATGG + Intergenic
1048518866 8:135135761-135135783 TTCTGGACGCTTTATAAACATGG + Intergenic
1048744069 8:137593593-137593615 TTATGCAGGCTATACAAGCATGG - Intergenic
1048838700 8:138546160-138546182 TTCTGCAGGCTCTACAAACATGG + Intergenic
1049650302 8:143763718-143763740 TTCTGCAGGCTGCACAAGCATGG - Intergenic
1049889788 9:58108-58130 TTCTGAAGGCTGTACAAGCCTGG - Intergenic
1050673458 9:8024655-8024677 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1050912007 9:11083068-11083090 TTCTGCAGGCTGTACAGGCAAGG + Intergenic
1050964702 9:11784188-11784210 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1051442226 9:17097793-17097815 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1051770275 9:20570307-20570329 TTCCGTCAGCATTACTAGCATGG + Intronic
1052399206 9:27979334-27979356 TTCTATAAGCTTAACATGTATGG + Intronic
1053438676 9:38095524-38095546 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1053456688 9:38238466-38238488 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1053731269 9:41059383-41059405 TTCTGAAGGCTGTACAAGCCTGG - Intergenic
1054697241 9:68372706-68372728 TTCTGAAGGCTGTACAAGCCTGG + Intronic
1054792456 9:69268816-69268838 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1054845030 9:69785683-69785705 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1054852278 9:69860214-69860236 TTCTGCAGGCTGTGCAAGCATGG + Intronic
1055074829 9:72203321-72203343 TTCTGGGAGCTTTGCAAGGAAGG + Intronic
1055147804 9:72957881-72957903 TTCTGTAGGCTGTACAAGCATGG + Intronic
1055148055 9:72959849-72959871 TTCTGCAGGCTGAACAAGCATGG + Intronic
1055666776 9:78560867-78560889 TTCCGCAAGCTGTATAAGCATGG + Intergenic
1055762158 9:79620780-79620802 TTCTGTAGGCTGCACAAGCATGG + Intronic
1055915177 9:81393435-81393457 AACTGTATGTTTTACAAGCATGG - Intergenic
1056003933 9:82247238-82247260 TTCTGCAGGCAATACAAGCATGG - Intergenic
1056021430 9:82441867-82441889 TTCTGTGCACTATACAAGCATGG - Intergenic
1056033520 9:82579541-82579563 TTCTGCAGGCTATACAAGCATGG - Intergenic
1056046405 9:82722137-82722159 GTCTGCAGGCTGTACAAGCATGG + Intergenic
1056056086 9:82825663-82825685 TTCTACAGGCTTTACAGGCAAGG + Intergenic
1056328220 9:85500034-85500056 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1056362612 9:85874056-85874078 TGCTGCAGGCTATACAAGCATGG + Intergenic
1058149342 9:101446903-101446925 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1058724415 9:107788247-107788269 TTCTGCAAGCTGTACAAGCATGG - Intergenic
1058752846 9:108055699-108055721 TGCTGTAAGATTTACCAGCATGG - Intergenic
1059202602 9:112431798-112431820 TTCTGCATGCTGTACAAGCATGG - Intronic
1059688941 9:116665153-116665175 TTCTGTAGGCTGTACAAGCATGG - Intronic
1059698362 9:116749943-116749965 TTCTGCAGGCTGTACAAACATGG - Intronic
1059884967 9:118735770-118735792 TTCTGCAAGCTGTACTAGCATGG - Intergenic
1060348908 9:122840316-122840338 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1060890138 9:127182913-127182935 TTCTGCAAGCTTTACAAGCATGG + Intronic
1062145742 9:134988729-134988751 TTCTGCAGGCTATACAAGCGTGG + Intergenic
1203473959 Un_GL000220v1:134669-134691 CTCTGGAAGGTTTCCAAGCAGGG - Intergenic
1185742587 X:2545751-2545773 TTCTGCAGACTGTACAAGCATGG - Intergenic
1186168140 X:6848846-6848868 TTCTGTAGGCTCTACAAGCATGG - Intergenic
1186252825 X:7687415-7687437 TTCTGTATGCTTTATAATAAGGG + Intergenic
1186300454 X:8195194-8195216 TGCTGCAGGCTGTACAAGCATGG + Intergenic
1186718163 X:12275358-12275380 TTCTGTAGGCTGTACAAACATGG - Intronic
1186803283 X:13114775-13114797 TTTTGCAGGCTGTACAAGCATGG + Intergenic
1187083325 X:16014914-16014936 TTTTGCAGGCTGTACAAGCATGG + Intergenic
1187455661 X:19439266-19439288 TTCTGCAGACTGTACAAGCATGG - Intronic
1187773967 X:22733934-22733956 TTTTGTAGACTGTACAAGCATGG + Intergenic
1187834807 X:23421182-23421204 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1188379576 X:29474547-29474569 TTCTGCATGCTGTACAAGCATGG + Intronic
1188500297 X:30818339-30818361 TTCGGTAGGCTGTACAGGCATGG - Intergenic
1188754129 X:33939260-33939282 TTTCGTGAGCTGTACAAGCATGG - Intergenic
1188888508 X:35581265-35581287 TTCTGCAGGCTGTACAAGTATGG - Intergenic
1188997328 X:36901954-36901976 TTCTACAGGCTGTACAAGCATGG + Intergenic
1189141841 X:38615205-38615227 TTCAGTGAGCTTTCTAAGCATGG + Intronic
1189207976 X:39258050-39258072 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1189232171 X:39461035-39461057 TTCTGCAGGCTGTACACGCATGG - Intergenic
1189707432 X:43772958-43772980 TTCTGCAGGCTATACAAGCATGG - Intronic
1189851180 X:45177600-45177622 TTCTGCAAGCTGTAGAAGCATGG - Intronic
1189860005 X:45262336-45262358 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1189916988 X:45865014-45865036 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1190517727 X:51242434-51242456 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1190539620 X:51463743-51463765 TTCTGCAGGCTACACAAGCATGG + Intergenic
1190780812 X:53593053-53593075 TTCTGCAAGCTTTGGAAGCATGG - Intronic
1192399483 X:70820514-70820536 TTCTGCAGGCTGTACAAGAATGG + Intronic
1192626207 X:72731163-72731185 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1192960145 X:76121439-76121461 TTCTGCAGGCTGTTCAAGCATGG - Intergenic
1193013496 X:76705929-76705951 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1193134613 X:77956659-77956681 TTCTGCAGGCTGTACAAGTATGG - Intronic
1193443052 X:81566278-81566300 TTCTGTAGGCTGTACAAACATGG - Intergenic
1193810209 X:86042371-86042393 TTCTGCAGGCTGTACAAGCATGG + Intronic
1193944326 X:87713900-87713922 TTCTGCAAAATGTACAAGCATGG - Intergenic
1194058912 X:89172541-89172563 TTCTGAAAGCCTTAAAACCAGGG - Intergenic
1194473311 X:94325511-94325533 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1194475063 X:94348355-94348377 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1194546304 X:95239275-95239297 TTCTGTAAACTTCACCACCAAGG + Intergenic
1195289674 X:103420124-103420146 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1195509080 X:105693548-105693570 TTCTGCCAACTGTACAAGCATGG - Intronic
1195659446 X:107363651-107363673 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1195815807 X:108885972-108885994 TTCTGCAGGCTCTACAAGGATGG - Intergenic
1196023095 X:111010739-111010761 TTCCGCAGGCTGTACAAGCATGG - Intronic
1196188160 X:112766407-112766429 TGCTTTAACCTTTACAAGGAAGG + Intergenic
1196488468 X:116242070-116242092 TTCTGTAAGCATCACAGGGAGGG + Intergenic
1196513973 X:116547877-116547899 TTCTGAAGGCTGTACAAGCATGG - Intergenic
1196541380 X:116912379-116912401 TTCTGCAAGCTGTACAAGCATGG - Intergenic
1196777487 X:119352779-119352801 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1196836843 X:119821265-119821287 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1197357942 X:125459569-125459591 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1197674379 X:129313852-129313874 TTCTGTACGCTGTACAAGCATGG + Intergenic
1197813793 X:130476089-130476111 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1198010829 X:132551942-132551964 ATCTGCAAGCTGTACAAACATGG - Intergenic
1198189697 X:134289672-134289694 TTCTGCACGCTGTACAAACATGG + Intergenic
1198446540 X:136723068-136723090 TTCTGGAAGTTTTACATACATGG - Intronic
1198599998 X:138272235-138272257 TTCTTCAGGCTATACAAGCATGG + Intergenic
1199019935 X:142867289-142867311 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1199071373 X:143479402-143479424 TTCTGCAGGCTGTACAAGGATGG + Intergenic
1199109358 X:143911694-143911716 TTCTGCAGGCCGTACAAGCAGGG + Intergenic
1199131753 X:144197148-144197170 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1199761652 X:150909178-150909200 CTCTGCAGGCTGTACAAGCATGG + Intergenic
1199785084 X:151098113-151098135 TTCTGCAGGCTGCACAAGCATGG - Intergenic
1200001625 X:153064703-153064725 GTCTGTAAGCTTGAGGAGCAAGG - Intergenic
1200465233 Y:3508547-3508569 TTCTGCAAGCTTCACCACCATGG + Intergenic
1201075609 Y:10185141-10185163 CTCTGGAAGGTTTCCAAGCAGGG - Intergenic