ID: 982387089

View in Genome Browser
Species Human (GRCh38)
Location 4:154819491-154819513
Sequence CAAGACAGTGACGAATTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982387089 Original CRISPR CAAGACAGTGACGAATTATG GGG (reversed) Intronic
906136828 1:43505910-43505932 AAAGGCAGTGACGCATAATGTGG + Intergenic
908126689 1:61038768-61038790 CAAGGTAGGGAAGAATTATGTGG - Intronic
908858616 1:68457123-68457145 CAATACAGTGACAAATTAACAGG - Intergenic
908955862 1:69626332-69626354 CAAGGCAGTAAAGAAATATGGGG - Intronic
909330446 1:74403217-74403239 AAATACAGTGAAGAATTAAGGGG - Intronic
909675595 1:78236018-78236040 CAGGACAGTGACCAATGGTGGGG + Intergenic
912440812 1:109696337-109696359 CATGACATTGACATATTATGAGG - Intronic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
920845859 1:209592525-209592547 CAGGGCAGTGAGGAATCATGGGG - Intronic
924030157 1:239878281-239878303 CAAGACAGTGACAGATCATTAGG + Intronic
924642344 1:245846144-245846166 CAAGACTGTGAGGAAGAATGAGG + Intronic
1063619374 10:7631653-7631675 CAGGCCAGTGTAGAATTATGTGG - Intronic
1069301729 10:66916207-66916229 AAAGACACTGATGAATTAAGTGG - Intronic
1069649208 10:70031750-70031772 CAAGGCAGTGACTACTCATGTGG + Intergenic
1070581096 10:77720154-77720176 CAAGATAGTGAAAAATTATCTGG + Intergenic
1074039029 10:109769823-109769845 CAAGACTGTGAGGATTTGTGGGG + Intergenic
1075013207 10:118892273-118892295 AAAGACAGTGACAGATTATCAGG + Intergenic
1075078144 10:119365114-119365136 CTAGACAGTTATGAAATATGTGG + Intronic
1076047071 10:127302524-127302546 CCAGACAATGACGGATTGTGTGG - Intronic
1076706529 10:132305032-132305054 CAAGACAGAGAGGAATGAAGGGG + Intronic
1080864401 11:36180544-36180566 CCAGACAGTGAAGCCTTATGAGG + Intronic
1084872277 11:72106249-72106271 CAAGACAGTGAAGGAATATTTGG + Intronic
1086106053 11:83148509-83148531 AAAGACACTGAAGAGTTATGTGG - Intergenic
1086366815 11:86115522-86115544 CAAGGCAGTGAGGAACTGTGGGG + Intergenic
1087480428 11:98693384-98693406 CAACACAGAGAGGAAATATGCGG + Intergenic
1090598459 11:128344542-128344564 TAAGAAAGAGAAGAATTATGAGG + Intergenic
1090601186 11:128373542-128373564 CAAGACAGTGAAACATTATTTGG - Intergenic
1092561907 12:9624170-9624192 CAAGACAGAGAAGACTTGTGCGG - Intergenic
1093328894 12:17811598-17811620 CCAGAGAGTGAGGAATTCTGTGG + Intergenic
1093862918 12:24189826-24189848 CAAGACATTGTCCAAATATGAGG + Intergenic
1095980328 12:47969513-47969535 CATGACAGTGATGACTGATGTGG + Intergenic
1097515661 12:60602242-60602264 CAAGTCAGTGTCTAATTTTGGGG - Intergenic
1097536006 12:60871917-60871939 GAAGACAGTAATGTATTATGTGG - Intergenic
1101922037 12:108940952-108940974 CCATACAGAGAGGAATTATGGGG + Intronic
1105461170 13:20589104-20589126 CAAGACAGTGAAGAATTACAAGG - Intronic
1106637103 13:31540785-31540807 CAAGAAAATGACAAATCATGAGG + Intergenic
1108485984 13:50925658-50925680 CAAGACCCTGAGGAAGTATGAGG + Intronic
1108678864 13:52762384-52762406 GAAGACAGTGACAAATCAAGAGG - Intergenic
1108942890 13:55979781-55979803 CATGGCAGTGAATAATTATGAGG - Intergenic
1109769202 13:66948041-66948063 CAAGACATTGTCAACTTATGTGG + Intronic
1110535844 13:76649968-76649990 CAAGGCAGTAAAGAATTATGGGG - Intergenic
1111612573 13:90622745-90622767 AAAAACAGTGACTAATTTTGTGG + Intergenic
1113610536 13:111641888-111641910 GAAGACAGTGAACAATTCTGGGG + Intronic
1118697233 14:68397118-68397140 CATTACAGTAAAGAATTATGAGG - Intronic
1120715161 14:87833613-87833635 CAAGCCAGTTAAGAATTAGGAGG + Intergenic
1122054870 14:99088835-99088857 CAAGACAGTGAAGAATTACAGGG + Intergenic
1126157715 15:45580936-45580958 CAATAAAGTGCTGAATTATGTGG - Intergenic
1127593433 15:60451923-60451945 CAAGATAGTGAGGAATTGTAGGG - Intronic
1129254067 15:74324355-74324377 CAAGTGAGTGAGGAATTATGGGG - Intronic
1129900051 15:79140426-79140448 CAAGACAATGATGAACTAAGTGG - Intergenic
1131458704 15:92603392-92603414 CAAGACAGTGAAGAATGACAGGG + Intergenic
1131789247 15:95946502-95946524 CAAGTCAGTGTTGAATTTTGGGG + Intergenic
1134909163 16:18008557-18008579 CAAGACAGGGCCGATTTATTTGG - Intergenic
1141895557 16:86956683-86956705 CCAGACAGTGACGATTCAGGCGG + Intergenic
1144355365 17:14440742-14440764 CAAGACAGTGAAGAATTACCAGG + Intergenic
1146990684 17:37268650-37268672 CAAGACAGTGAAGAATTATGGGG - Intronic
1150503511 17:65674327-65674349 CAAGGCAGGGAAGAATTATGGGG + Intronic
1152090940 17:78247391-78247413 CAAGGCAGTCATGAATTGTGAGG - Intergenic
1162245348 19:9395363-9395385 CAATACAGTGAGGATTTGTGAGG + Intergenic
1166550576 19:43663255-43663277 CCAGACAGTGACTGATTATTAGG - Intronic
932638920 2:73421702-73421724 CAAGAGGGTGATGAATTATATGG + Intronic
936042382 2:109159827-109159849 GAAGACAGTGACAGATCATGAGG - Intronic
936871077 2:117134656-117134678 CAAGACAGTGGCGAAGTGTTGGG - Intergenic
938316056 2:130328827-130328849 AAAGACAGTGAGCCATTATGGGG - Intergenic
944096253 2:195971833-195971855 CATGAGAGTGAGCAATTATGAGG + Intronic
945425432 2:209694820-209694842 CAAGACAGTGAGAATTTATCAGG + Exonic
945454437 2:210033892-210033914 CAAGACAGTAACGAATTAGAAGG - Intronic
948306548 2:236952420-236952442 AAAGACAGTGACAGATTATCAGG - Intergenic
1169092333 20:2868663-2868685 CAGGGCAGTGAGGAATTGTGGGG - Intronic
1169472811 20:5902765-5902787 CAAGAGAGTGAAGAATGATCAGG - Intergenic
1178565589 21:33681432-33681454 CAAGAAAGTAACGTATTCTGAGG + Intronic
1180891920 22:19295078-19295100 AAAGGCAGTGAATAATTATGAGG + Intergenic
1183361890 22:37387104-37387126 CATGACAGTGAGGAAGGATGGGG + Intronic
1183834057 22:40437429-40437451 CAAGACAGTGATGAGTGCTGCGG - Intronic
1184396296 22:44243593-44243615 CAAAAGAGTGACAAATTATGCGG + Intergenic
1184906422 22:47489555-47489577 CATGACAGTGACAGATTCTGGGG - Intergenic
955800980 3:62686139-62686161 CAAGACAATTACGAAGAATGAGG + Intronic
956552056 3:70472293-70472315 AAAGACAGTGACAGATTATCAGG - Intergenic
960045713 3:113195751-113195773 CCACACAGTGAGAAATTATGGGG + Intergenic
963938441 3:151077631-151077653 CAAGACAGTGAAATATAATGTGG - Intergenic
966357124 3:179092670-179092692 CAAGACACTGATTAATTATAAGG - Intergenic
970179103 4:13370309-13370331 GAAGACTGTGAAGAATTATGAGG + Intronic
979040640 4:115788640-115788662 CAAGAAATTCACAAATTATGGGG - Intergenic
979573929 4:122264285-122264307 CAAGACAGTGTTGAAATCTGAGG - Exonic
981426443 4:144608782-144608804 TAAGACAGTGGTGAATTGTGTGG - Intergenic
982387089 4:154819491-154819513 CAAGACAGTGACGAATTATGGGG - Intronic
983441218 4:167788302-167788324 CCAGACAGTGACAAAATGTGGGG + Intergenic
984302246 4:177936473-177936495 CAAGATAGTTACAAATTTTGAGG - Intronic
985818042 5:2141324-2141346 AAACACAGTGAAGAATTATCAGG - Intergenic
988004396 5:25389154-25389176 CAAGTCAGTGACAAATAATCAGG + Intergenic
989514134 5:42322109-42322131 CCAGACATTGGAGAATTATGTGG + Intergenic
990595329 5:57307355-57307377 CAAGAGAGTGAGGAATTATTTGG - Intergenic
995425060 5:112011825-112011847 AAATTCAGTGACGAATTATAAGG - Intergenic
998002419 5:138635544-138635566 CAAGAGAAGGAAGAATTATGAGG - Intronic
1003761474 6:9183282-9183304 CAAGACAGTGACAAATTACCTGG + Intergenic
1011411004 6:87066128-87066150 AAAAACAGAGAAGAATTATGTGG + Intergenic
1012808294 6:103923815-103923837 CAAGAGAATGACAAATTAAGGGG + Intergenic
1017334608 6:153240652-153240674 AAATACAGTGGAGAATTATGTGG + Intergenic
1017369321 6:153686497-153686519 CAAGACTGTAACTAAATATGTGG + Intergenic
1023295855 7:38714546-38714568 CCAGACAGTGAAGAATGATTCGG - Intergenic
1030302578 7:107989255-107989277 CAACACAGTGATGCATTTTGGGG + Intronic
1030432770 7:109472401-109472423 CAAAGCAGTGAAGAATCATGGGG + Intergenic
1041381151 8:57255413-57255435 CAAGACAATGAAGAACTATAAGG - Intergenic
1042668902 8:71238295-71238317 CAATAGCGTGAAGAATTATGCGG - Intronic
1048365234 8:133732750-133732772 GAAGACAGTGAGCAATTAGGAGG + Intergenic
1052272507 9:26641252-26641274 CAAGACAGTGACCTGTTAGGAGG + Intergenic
1053027893 9:34745956-34745978 CAAAGCACTGAGGAATTATGGGG + Intergenic
1053360145 9:37480197-37480219 CAAGACAGTGAAGTATTGTATGG + Intergenic
1060195843 9:121622836-121622858 CAAGACAGTGACAAGTACTGTGG + Intronic
1188201386 X:27295967-27295989 CAAGACAATGAAGAATTATCAGG + Intergenic
1188974169 X:36653642-36653664 CATCACAGTGACTAGTTATGGGG - Intergenic
1189108478 X:38261343-38261365 CAGGACAGTAAAGAATTATGAGG - Intronic
1194225529 X:91252083-91252105 CAAGACAGAAAAGAATTATCAGG - Intergenic
1196505050 X:116432198-116432220 CAAGATAGTGACCAATCTTGGGG + Intergenic
1199722374 X:150551129-150551151 CAAGACTGTGAGGAAGCATGTGG + Intergenic
1199751664 X:150825410-150825432 CAAGACTGTGTGGAACTATGTGG - Intronic
1201172528 Y:11282744-11282766 AAAGACATTGAGGATTTATGGGG - Intergenic