ID: 982388293

View in Genome Browser
Species Human (GRCh38)
Location 4:154836717-154836739
Sequence GGGTTAACTTATCCCCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982388293_982388301 16 Left 982388293 4:154836717-154836739 CCTCACTGGGGATAAGTTAACCC No data
Right 982388301 4:154836756-154836778 CTCATTGTTAGAAGCTGGGAAGG No data
982388293_982388299 11 Left 982388293 4:154836717-154836739 CCTCACTGGGGATAAGTTAACCC No data
Right 982388299 4:154836751-154836773 GCAGTCTCATTGTTAGAAGCTGG No data
982388293_982388300 12 Left 982388293 4:154836717-154836739 CCTCACTGGGGATAAGTTAACCC No data
Right 982388300 4:154836752-154836774 CAGTCTCATTGTTAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982388293 Original CRISPR GGGTTAACTTATCCCCAGTG AGG (reversed) Intergenic
No off target data available for this crispr