ID: 982388294

View in Genome Browser
Species Human (GRCh38)
Location 4:154836737-154836759
Sequence TGAGACTGCTTGGCTGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982388294_982388299 -9 Left 982388294 4:154836737-154836759 CCCCTTCCAGCCAAGCAGTCTCA No data
Right 982388299 4:154836751-154836773 GCAGTCTCATTGTTAGAAGCTGG No data
982388294_982388301 -4 Left 982388294 4:154836737-154836759 CCCCTTCCAGCCAAGCAGTCTCA No data
Right 982388301 4:154836756-154836778 CTCATTGTTAGAAGCTGGGAAGG No data
982388294_982388303 19 Left 982388294 4:154836737-154836759 CCCCTTCCAGCCAAGCAGTCTCA No data
Right 982388303 4:154836779-154836801 AAGTGTCTGCCCAGATAACAGGG No data
982388294_982388302 18 Left 982388294 4:154836737-154836759 CCCCTTCCAGCCAAGCAGTCTCA No data
Right 982388302 4:154836778-154836800 GAAGTGTCTGCCCAGATAACAGG No data
982388294_982388306 30 Left 982388294 4:154836737-154836759 CCCCTTCCAGCCAAGCAGTCTCA No data
Right 982388306 4:154836790-154836812 CAGATAACAGGGCTGAAAAATGG No data
982388294_982388300 -8 Left 982388294 4:154836737-154836759 CCCCTTCCAGCCAAGCAGTCTCA No data
Right 982388300 4:154836752-154836774 CAGTCTCATTGTTAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982388294 Original CRISPR TGAGACTGCTTGGCTGGAAG GGG (reversed) Intergenic
No off target data available for this crispr