ID: 982388295

View in Genome Browser
Species Human (GRCh38)
Location 4:154836738-154836760
Sequence ATGAGACTGCTTGGCTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982388295_982388306 29 Left 982388295 4:154836738-154836760 CCCTTCCAGCCAAGCAGTCTCAT No data
Right 982388306 4:154836790-154836812 CAGATAACAGGGCTGAAAAATGG No data
982388295_982388301 -5 Left 982388295 4:154836738-154836760 CCCTTCCAGCCAAGCAGTCTCAT No data
Right 982388301 4:154836756-154836778 CTCATTGTTAGAAGCTGGGAAGG No data
982388295_982388299 -10 Left 982388295 4:154836738-154836760 CCCTTCCAGCCAAGCAGTCTCAT No data
Right 982388299 4:154836751-154836773 GCAGTCTCATTGTTAGAAGCTGG No data
982388295_982388300 -9 Left 982388295 4:154836738-154836760 CCCTTCCAGCCAAGCAGTCTCAT No data
Right 982388300 4:154836752-154836774 CAGTCTCATTGTTAGAAGCTGGG No data
982388295_982388302 17 Left 982388295 4:154836738-154836760 CCCTTCCAGCCAAGCAGTCTCAT No data
Right 982388302 4:154836778-154836800 GAAGTGTCTGCCCAGATAACAGG No data
982388295_982388303 18 Left 982388295 4:154836738-154836760 CCCTTCCAGCCAAGCAGTCTCAT No data
Right 982388303 4:154836779-154836801 AAGTGTCTGCCCAGATAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982388295 Original CRISPR ATGAGACTGCTTGGCTGGAA GGG (reversed) Intergenic
No off target data available for this crispr