ID: 982388299

View in Genome Browser
Species Human (GRCh38)
Location 4:154836751-154836773
Sequence GCAGTCTCATTGTTAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982388293_982388299 11 Left 982388293 4:154836717-154836739 CCTCACTGGGGATAAGTTAACCC No data
Right 982388299 4:154836751-154836773 GCAGTCTCATTGTTAGAAGCTGG No data
982388294_982388299 -9 Left 982388294 4:154836737-154836759 CCCCTTCCAGCCAAGCAGTCTCA No data
Right 982388299 4:154836751-154836773 GCAGTCTCATTGTTAGAAGCTGG No data
982388295_982388299 -10 Left 982388295 4:154836738-154836760 CCCTTCCAGCCAAGCAGTCTCAT No data
Right 982388299 4:154836751-154836773 GCAGTCTCATTGTTAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982388299 Original CRISPR GCAGTCTCATTGTTAGAAGC TGG Intergenic
No off target data available for this crispr