ID: 982388300

View in Genome Browser
Species Human (GRCh38)
Location 4:154836752-154836774
Sequence CAGTCTCATTGTTAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982388296_982388300 -10 Left 982388296 4:154836739-154836761 CCTTCCAGCCAAGCAGTCTCATT No data
Right 982388300 4:154836752-154836774 CAGTCTCATTGTTAGAAGCTGGG No data
982388294_982388300 -8 Left 982388294 4:154836737-154836759 CCCCTTCCAGCCAAGCAGTCTCA No data
Right 982388300 4:154836752-154836774 CAGTCTCATTGTTAGAAGCTGGG No data
982388295_982388300 -9 Left 982388295 4:154836738-154836760 CCCTTCCAGCCAAGCAGTCTCAT No data
Right 982388300 4:154836752-154836774 CAGTCTCATTGTTAGAAGCTGGG No data
982388293_982388300 12 Left 982388293 4:154836717-154836739 CCTCACTGGGGATAAGTTAACCC No data
Right 982388300 4:154836752-154836774 CAGTCTCATTGTTAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982388300 Original CRISPR CAGTCTCATTGTTAGAAGCT GGG Intergenic
No off target data available for this crispr