ID: 982388601

View in Genome Browser
Species Human (GRCh38)
Location 4:154839262-154839284
Sequence TTCCCTCAGCCCCCCATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982388601_982388606 -4 Left 982388601 4:154839262-154839284 CCAGTGATGGGGGGCTGAGGGAA No data
Right 982388606 4:154839281-154839303 GGAAAAGGAGGTGGTAAGGCAGG 0: 2
1: 9
2: 18
3: 70
4: 589
982388601_982388607 26 Left 982388601 4:154839262-154839284 CCAGTGATGGGGGGCTGAGGGAA No data
Right 982388607 4:154839311-154839333 TCCTCCTCCTTCCCCATTTTAGG No data
982388601_982388605 -8 Left 982388601 4:154839262-154839284 CCAGTGATGGGGGGCTGAGGGAA No data
Right 982388605 4:154839277-154839299 TGAGGGAAAAGGAGGTGGTAAGG 0: 2
1: 9
2: 20
3: 79
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982388601 Original CRISPR TTCCCTCAGCCCCCCATCAC TGG (reversed) Intergenic
No off target data available for this crispr