ID: 982392100

View in Genome Browser
Species Human (GRCh38)
Location 4:154876177-154876199
Sequence GAGAGCTATAATATTTAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982392100_982392105 26 Left 982392100 4:154876177-154876199 CCCCTTTAAATATTATAGCTCTC No data
Right 982392105 4:154876226-154876248 ACCACATATTCCTTTTTTCTAGG No data
982392100_982392104 3 Left 982392100 4:154876177-154876199 CCCCTTTAAATATTATAGCTCTC No data
Right 982392104 4:154876203-154876225 ATAATCTTTGGAAAAAGACATGG No data
982392100_982392103 -9 Left 982392100 4:154876177-154876199 CCCCTTTAAATATTATAGCTCTC No data
Right 982392103 4:154876191-154876213 ATAGCTCTCAAAATAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982392100 Original CRISPR GAGAGCTATAATATTTAAAG GGG (reversed) Intergenic
No off target data available for this crispr