ID: 982398544

View in Genome Browser
Species Human (GRCh38)
Location 4:154940311-154940333
Sequence GGTCACAGTGGAATACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982398544_982398549 5 Left 982398544 4:154940311-154940333 CCAGGCTGTATTCCACTGTGACC No data
Right 982398549 4:154940339-154940361 GAGAGAGAATCAGACGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982398544 Original CRISPR GGTCACAGTGGAATACAGCC TGG (reversed) Intergenic
No off target data available for this crispr