ID: 982402402

View in Genome Browser
Species Human (GRCh38)
Location 4:154982795-154982817
Sequence TGTGTTGATGCTGCTTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982402399_982402402 10 Left 982402399 4:154982762-154982784 CCGAGGCGCGGGCTGTGGGAAGT No data
Right 982402402 4:154982795-154982817 TGTGTTGATGCTGCTTTTCTTGG No data
982402394_982402402 25 Left 982402394 4:154982747-154982769 CCTCATTGAAGGGCACCGAGGCG No data
Right 982402402 4:154982795-154982817 TGTGTTGATGCTGCTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982402402 Original CRISPR TGTGTTGATGCTGCTTTTCT TGG Intergenic
No off target data available for this crispr