ID: 982412672

View in Genome Browser
Species Human (GRCh38)
Location 4:155096884-155096906
Sequence TAGGCTGCACCACTAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982412672_982412675 -3 Left 982412672 4:155096884-155096906 CCCTGCTCTAGTGGTGCAGCCTA No data
Right 982412675 4:155096904-155096926 CTACCTAGACTTTCACTGCATGG No data
982412672_982412680 29 Left 982412672 4:155096884-155096906 CCCTGCTCTAGTGGTGCAGCCTA No data
Right 982412680 4:155096936-155096958 CTCTAGAGGACAGTCTTTTGGGG No data
982412672_982412677 15 Left 982412672 4:155096884-155096906 CCCTGCTCTAGTGGTGCAGCCTA No data
Right 982412677 4:155096922-155096944 CATGGCTTTCTTCACTCTAGAGG No data
982412672_982412679 28 Left 982412672 4:155096884-155096906 CCCTGCTCTAGTGGTGCAGCCTA No data
Right 982412679 4:155096935-155096957 ACTCTAGAGGACAGTCTTTTGGG No data
982412672_982412678 27 Left 982412672 4:155096884-155096906 CCCTGCTCTAGTGGTGCAGCCTA No data
Right 982412678 4:155096934-155096956 CACTCTAGAGGACAGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982412672 Original CRISPR TAGGCTGCACCACTAGAGCA GGG (reversed) Intergenic
No off target data available for this crispr