ID: 982423144

View in Genome Browser
Species Human (GRCh38)
Location 4:155221699-155221721
Sequence CAATGCTGAGTGAAGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982423141_982423144 -9 Left 982423141 4:155221685-155221707 CCAGTGTGGATATGCAATGCTGA No data
Right 982423144 4:155221699-155221721 CAATGCTGAGTGAAGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982423144 Original CRISPR CAATGCTGAGTGAAGGGTCC TGG Intergenic
No off target data available for this crispr