ID: 982425131

View in Genome Browser
Species Human (GRCh38)
Location 4:155249250-155249272
Sequence CACAGCCACCACTCACAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982425130_982425131 2 Left 982425130 4:155249225-155249247 CCGTGCTAACACAGTCAGTGGTA No data
Right 982425131 4:155249250-155249272 CACAGCCACCACTCACAATTAGG No data
982425128_982425131 28 Left 982425128 4:155249199-155249221 CCTTTGTCGCTGGCATGCTCTGT No data
Right 982425131 4:155249250-155249272 CACAGCCACCACTCACAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982425131 Original CRISPR CACAGCCACCACTCACAATT AGG Intergenic
No off target data available for this crispr