ID: 982442026

View in Genome Browser
Species Human (GRCh38)
Location 4:155447674-155447696
Sequence CCCCACTTGGCTTTTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982442026_982442032 14 Left 982442026 4:155447674-155447696 CCCATGGCAAAAGCCAAGTGGGG No data
Right 982442032 4:155447711-155447733 ACTCATGCCTGACTGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982442026 Original CRISPR CCCCACTTGGCTTTTGCCAT GGG (reversed) Intergenic
No off target data available for this crispr