ID: 982442433

View in Genome Browser
Species Human (GRCh38)
Location 4:155452730-155452752
Sequence TACCACAGCGATGGCTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982442430_982442433 10 Left 982442430 4:155452697-155452719 CCATTTGTGTGGTATGATGATTG No data
Right 982442433 4:155452730-155452752 TACCACAGCGATGGCTACTGAGG No data
982442428_982442433 12 Left 982442428 4:155452695-155452717 CCCCATTTGTGTGGTATGATGAT No data
Right 982442433 4:155452730-155452752 TACCACAGCGATGGCTACTGAGG No data
982442429_982442433 11 Left 982442429 4:155452696-155452718 CCCATTTGTGTGGTATGATGATT No data
Right 982442433 4:155452730-155452752 TACCACAGCGATGGCTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982442433 Original CRISPR TACCACAGCGATGGCTACTG AGG Intergenic
No off target data available for this crispr