ID: 982446559

View in Genome Browser
Species Human (GRCh38)
Location 4:155497495-155497517
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982446554_982446559 8 Left 982446554 4:155497464-155497486 CCTGCTTTCTGATTCACAGACTG No data
Right 982446559 4:155497495-155497517 CCTTGTGTCCACATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr