ID: 982449483

View in Genome Browser
Species Human (GRCh38)
Location 4:155535222-155535244
Sequence CCTTGCACACATGAGTTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982449483_982449486 30 Left 982449483 4:155535222-155535244 CCATACAACTCATGTGTGCAAGG No data
Right 982449486 4:155535275-155535297 TATAGTGCCTAACACCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982449483 Original CRISPR CCTTGCACACATGAGTTGTA TGG (reversed) Intergenic
No off target data available for this crispr