ID: 982455987

View in Genome Browser
Species Human (GRCh38)
Location 4:155610185-155610207
Sequence AGTCCCACCCCCATTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982455987_982455993 14 Left 982455987 4:155610185-155610207 CCCTCACCAATGGGGGTGGGACT No data
Right 982455993 4:155610222-155610244 AGGGTCCAGATAGAACAAAAAGG No data
982455987_982455990 -6 Left 982455987 4:155610185-155610207 CCCTCACCAATGGGGGTGGGACT No data
Right 982455990 4:155610202-155610224 GGGACTCATCCAATTTGTTGAGG No data
982455987_982455996 24 Left 982455987 4:155610185-155610207 CCCTCACCAATGGGGGTGGGACT No data
Right 982455996 4:155610232-155610254 TAGAACAAAAAGGCATAGGAAGG No data
982455987_982455997 25 Left 982455987 4:155610185-155610207 CCCTCACCAATGGGGGTGGGACT No data
Right 982455997 4:155610233-155610255 AGAACAAAAAGGCATAGGAAGGG No data
982455987_982455991 -5 Left 982455987 4:155610185-155610207 CCCTCACCAATGGGGGTGGGACT No data
Right 982455991 4:155610203-155610225 GGACTCATCCAATTTGTTGAGGG No data
982455987_982455995 20 Left 982455987 4:155610185-155610207 CCCTCACCAATGGGGGTGGGACT No data
Right 982455995 4:155610228-155610250 CAGATAGAACAAAAAGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982455987 Original CRISPR AGTCCCACCCCCATTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr