ID: 982458074

View in Genome Browser
Species Human (GRCh38)
Location 4:155634457-155634479
Sequence CACGAGAGTGACGCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982458074_982458075 2 Left 982458074 4:155634457-155634479 CCTGCAACAGCGTCACTCTCGTG No data
Right 982458075 4:155634482-155634504 TTTCAAAGTGTTTGCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982458074 Original CRISPR CACGAGAGTGACGCTGTTGC AGG (reversed) Intergenic
No off target data available for this crispr