ID: 982458075

View in Genome Browser
Species Human (GRCh38)
Location 4:155634482-155634504
Sequence TTTCAAAGTGTTTGCTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982458073_982458075 3 Left 982458073 4:155634456-155634478 CCCTGCAACAGCGTCACTCTCGT No data
Right 982458075 4:155634482-155634504 TTTCAAAGTGTTTGCTTCAGTGG No data
982458074_982458075 2 Left 982458074 4:155634457-155634479 CCTGCAACAGCGTCACTCTCGTG No data
Right 982458075 4:155634482-155634504 TTTCAAAGTGTTTGCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982458075 Original CRISPR TTTCAAAGTGTTTGCTTCAG TGG Intergenic
No off target data available for this crispr