ID: 982460636

View in Genome Browser
Species Human (GRCh38)
Location 4:155665630-155665652
Sequence ACACTGTTATTCAAGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982460636 Original CRISPR ACACTGTTATTCAAGAAACA AGG (reversed) Intergenic
901591569 1:10348491-10348513 ACATTGTTATTCAAAACAAAGGG - Intronic
902915077 1:19633395-19633417 ACACTGTTATTGAGGAGAGAAGG + Intronic
904741519 1:32680105-32680127 TCACTTTTATTCAGGAAATAGGG + Exonic
908587546 1:65588016-65588038 ACACTGTTTTTCAAAGAACCTGG - Intronic
908713301 1:67042755-67042777 ACAGTGTCATTTAAGAAAGATGG + Intronic
909312411 1:74169555-74169577 ACACTTTTTTTTAAGAGACAGGG + Intronic
909494180 1:76259890-76259912 ACACTGTTGTTCTAGAACCTGGG + Intronic
910105110 1:83623825-83623847 ACACTGGTTATTAAGAAACATGG - Intergenic
910617138 1:89210974-89210996 AAACAGTTATTTATGAAACAAGG + Intergenic
910955871 1:92703955-92703977 ATACTGTTATTCAAGAATGCAGG + Intronic
915791732 1:158679511-158679533 ACACTGGTATGTAAGAAGCATGG + Intronic
916934802 1:169616642-169616664 TCTCTGTTATACAAGACACAGGG + Intronic
919616585 1:199815597-199815619 ACACTGGTACACAAGACACATGG - Intergenic
921018589 1:211215190-211215212 ACACTATTTTTCAAGAATAAGGG + Intergenic
922379315 1:225006334-225006356 ACAATGATTTTCAGGAAACAAGG + Intronic
923127559 1:231045779-231045801 ACACTGTCATTCAGGAATGAGGG + Intergenic
923803194 1:237230512-237230534 ATTCTGTTTTTCAAGAAACTAGG + Intronic
1065171978 10:23040174-23040196 ACACAGTCATTCAAGAACCCAGG + Intergenic
1065828718 10:29595476-29595498 ACACTGTTATTTACAAAAGATGG + Intronic
1066598749 10:37080703-37080725 ACATAGTCATTCAAGAAACACGG - Intergenic
1068347706 10:55804372-55804394 ACACTGTTACTCTTGAAAAAAGG + Intergenic
1073903912 10:108254667-108254689 AAACTGTCATCCAAGGAACAAGG + Intergenic
1074356907 10:112794086-112794108 ACAGTTTTATTCAAGGAAAAAGG + Intronic
1075433423 10:122410715-122410737 ATACTGTAATTTAAGAAAAATGG + Intronic
1076057715 10:127389249-127389271 TCACTTTTGTTTAAGAAACAAGG + Intronic
1079332188 11:19542762-19542784 AAACTGAGATTCAGGAAACATGG + Intronic
1079983241 11:27174185-27174207 ACAGTGTTGAACAAGAAACAAGG + Intergenic
1081004593 11:37719117-37719139 AGACTGTTTTTCAAAAAACAGGG + Intergenic
1081129271 11:39357154-39357176 TAACTTTTATTCAAGTAACATGG - Intergenic
1081206008 11:40276566-40276588 CCTCTGTTATTCAAGGTACAAGG - Intronic
1081521878 11:43889687-43889709 ACATTGTTAACCAAAAAACATGG - Intronic
1082309295 11:50627046-50627068 ACACTGTTTTTGTAGAAACTGGG + Intergenic
1082878411 11:58012567-58012589 AAACTATTATTCAAGAAAGAGGG + Intergenic
1085743543 11:79096320-79096342 ACACAGTCAATGAAGAAACAAGG + Intronic
1085887956 11:80542743-80542765 ATACTATTAATAAAGAAACAAGG - Intergenic
1088659931 11:112035379-112035401 ACACTGGTATTCAAGTTAAATGG - Intronic
1090045556 11:123329295-123329317 ACACTGCTACTCATGAAACGGGG - Intergenic
1093705149 12:22266788-22266810 ACACATTTTTTCAAGAGACAGGG - Intronic
1093896258 12:24577970-24577992 ACATTGATATTCAAGAAAATGGG + Intergenic
1094005723 12:25748561-25748583 ACACTTTTGTGCCAGAAACAAGG - Intergenic
1094128280 12:27046659-27046681 ACATATTTATTCAAGAAATATGG - Intronic
1094869684 12:34587058-34587080 ACACTGTTTTTCTAGAATCTGGG - Intergenic
1097607007 12:61768281-61768303 ACACTGTCAGTCAAAAAAAATGG + Intronic
1098184535 12:67882249-67882271 ACAGTGTTGTTAAAGAAACCAGG + Intergenic
1099027940 12:77489600-77489622 ACCCAGAAATTCAAGAAACAAGG + Intergenic
1099336025 12:81358951-81358973 ACACTAGTTTTCAATAAACATGG + Intronic
1100153404 12:91769116-91769138 ATTCTGTCATTCAACAAACATGG + Intergenic
1100222339 12:92518754-92518776 ACACAGTCATTCAGGAACCAAGG - Intergenic
1103151384 12:118641996-118642018 ACACTGGTATCCCAGGAACATGG - Intergenic
1106566366 13:30888040-30888062 TCACTGTTAATAAAGAAACCTGG - Intergenic
1106725307 13:32478374-32478396 ACACTGTTATTCCTGAGAGATGG + Intronic
1107254770 13:38411398-38411420 TTACTGTTTTTAAAGAAACATGG - Intergenic
1108383569 13:49877526-49877548 AAAATGTTATTTATGAAACAAGG + Intergenic
1110968184 13:81727413-81727435 ACATTGTCATTAAAGAAACCTGG - Intergenic
1111080776 13:83304328-83304350 ATACTTTTTTTGAAGAAACATGG + Intergenic
1112337415 13:98526689-98526711 ATTCTGTTTTTCAAGAAACTTGG + Intronic
1112700546 13:102002585-102002607 AAACTGTTCTTCAAGTAAAAGGG - Intronic
1114323336 14:21565495-21565517 TCACTTTTATTCAGGAAATAGGG + Intergenic
1114394485 14:22344618-22344640 ACAGTGATTTTCAGGAAACAAGG - Intergenic
1114597229 14:23923850-23923872 CCACTATTATTCAAGAGACCTGG + Intergenic
1114757725 14:25279195-25279217 AAACTGTTATTCAAATAAAAGGG + Intergenic
1117023758 14:51598704-51598726 ATAATGTTATTTGAGAAACATGG - Intronic
1117126786 14:52637562-52637584 ACACTGTTAAACAATAAAAAAGG - Exonic
1120119560 14:80662580-80662602 ACACTGCAAATCAAGAAAAATGG + Intronic
1120581874 14:86261955-86261977 ACAGTGTTATTCAACATTCATGG - Intergenic
1120931535 14:89853736-89853758 AGACTGTAATTTAACAAACAAGG + Intronic
1121064880 14:90953485-90953507 ACAGTGATTTTCAAGGAACAAGG + Intronic
1121812714 14:96905682-96905704 ACACTAATGTTCAAGAAACATGG - Intronic
1122920502 14:104878024-104878046 ACCCTGTTACTCCAGAAGCAGGG + Intronic
1124009382 15:25824755-25824777 AAACATTTATTCAAGAAAAATGG + Intronic
1126468524 15:48982796-48982818 ACACTTTTCTCCTAGAAACAAGG + Intergenic
1129900065 15:79140569-79140591 CCACTGTTTTTCAAATAACATGG + Intergenic
1130135480 15:81178304-81178326 ACACTTTTTTTTAAGAGACAGGG + Intronic
1131100598 15:89686401-89686423 TCACTGTCCCTCAAGAAACAGGG + Intronic
1131424102 15:92331284-92331306 ACACTGTAATAAAAGAAACTAGG + Intergenic
1131575016 15:93580154-93580176 CCCCTGCTATACAAGAAACATGG + Intergenic
1131760644 15:95618960-95618982 ACACTGTCATTTAACAATCACGG + Intergenic
1131852568 15:96558439-96558461 ACACTTCTTTCCAAGAAACATGG + Intergenic
1133628722 16:7597646-7597668 ACAGAGTTATTCTAGAAAGAAGG - Intronic
1134758835 16:16695152-16695174 CCAATATTATCCAAGAAACAGGG + Intergenic
1134987240 16:18664019-18664041 CCAATATTATCCAAGAAACAGGG - Intergenic
1135964569 16:27025025-27025047 GAAATGTCATTCAAGAAACAAGG + Intergenic
1136665566 16:31808981-31809003 AAACTCTTATTTAAAAAACAGGG - Intergenic
1137289180 16:47040096-47040118 GCTCTTTTATTCAACAAACAAGG - Intergenic
1137451258 16:48576903-48576925 ACACTTTTATTTTAGAGACAGGG + Intronic
1138101813 16:54258016-54258038 ACGCTGTTATACAAGCCACAAGG - Intronic
1138407269 16:56806445-56806467 ACACTTGTTTTCAACAAACAAGG - Intronic
1140539408 16:75742406-75742428 AAAATGTTATTTATGAAACAAGG + Intronic
1141225341 16:82109681-82109703 GGACTGTTATTGAAGAAAAATGG + Intergenic
1143177810 17:4966777-4966799 TAACGGTTGTTCAAGAAACAAGG + Intronic
1143242817 17:5458361-5458383 ACTGTGTTGTTCAAGAAACAAGG + Intronic
1146381674 17:32334302-32334324 ACAATATAATTCTAGAAACATGG - Intronic
1150022017 17:61626434-61626456 ACAATATTATTCAGGAAAGAAGG - Intergenic
1150357522 17:64499834-64499856 AGATAGTTATTTAAGAAACATGG - Exonic
1150734947 17:67728791-67728813 ACACAGCTATTCAAAAAGCAAGG - Intronic
1150790076 17:68196351-68196373 ATACTGTTATACAGGAAACCTGG + Intergenic
1151036876 17:70810809-70810831 TCACTGTTATCCAAAAAACCTGG - Intergenic
1152126086 17:78447857-78447879 AAAATGTTTTTAAAGAAACAGGG - Intronic
1154336735 18:13471809-13471831 ACACTGTTCTTCAAGAAAAATGG - Intronic
1154489194 18:14906359-14906381 AGAGAGTCATTCAAGAAACATGG - Intergenic
1155400000 18:25427611-25427633 ACACTGTTATTTCAGAAACCAGG - Intergenic
1156632249 18:38984207-38984229 TCACTGTTATGCAAACAACAAGG - Intergenic
1156784027 18:40887901-40887923 ACCTTTTTATTCAAGAAACTAGG - Intergenic
1158474860 18:57770834-57770856 TCACCGTTCTTCTAGAAACATGG + Intronic
1159725399 18:71951707-71951729 ACACTGTTTTCCAAAAAACCAGG + Intergenic
1164364114 19:27555086-27555108 ACACTGTTTTTCTAGAATCTGGG + Intergenic
1165125961 19:33597569-33597591 ACACTGTTATTTAACAAAAGAGG - Intergenic
1168588083 19:57610639-57610661 ACACTGTTCCTCAGGAAACAGGG + Intronic
925014404 2:510822-510844 ACACAGTTCTTGAAGAAACAAGG - Intergenic
926691280 2:15735784-15735806 ATACTGTTATTCAAATAACAAGG - Intronic
928043699 2:27905627-27905649 ACATTGTTATTTTAGAATCAGGG + Intronic
928984294 2:37166028-37166050 ACACTTTTTTTTAAGAGACAAGG + Intergenic
930574513 2:53129877-53129899 ACCCAGTTATTCAAAAAATAAGG + Intergenic
930575903 2:53148651-53148673 ATACTGCTAACCAAGAAACAGGG - Intergenic
932390533 2:71386529-71386551 ACAATGTAATTCAAGAGGCATGG + Intronic
933455136 2:82510138-82510160 ATACTGTTATTAAATAAACCTGG - Intergenic
933907724 2:86912179-86912201 ACACAGTTATTCAGGAACCCAGG + Intronic
933908972 2:86921894-86921916 ACACAGTTATTCAGGAACCCAGG + Intronic
934023752 2:87981491-87981513 ACACAGTTATTCAGGAACCCAGG - Intergenic
936364405 2:111839214-111839236 ACACAGTTATTCAGGAACCCAGG - Intronic
936913300 2:117614679-117614701 ACATTCTTATTAAAGAATCAGGG + Intergenic
938648785 2:133358568-133358590 ACACATTTTTTCAAGAGACAGGG - Intronic
939814325 2:146875080-146875102 AGGCTGTTGTTCATGAAACATGG - Intergenic
940911058 2:159210385-159210407 ACACAGTCATTCCACAAACAGGG - Intronic
941306570 2:163876579-163876601 ACACAGTTATTAAACAAATATGG - Intergenic
941474570 2:165934299-165934321 AAACTGTTATAAGAGAAACACGG + Intronic
941944226 2:171076947-171076969 ACACTGGTACTCAAGAAACACGG + Intronic
944114696 2:196173522-196173544 GCACTGTGGTTCAAGTAACAAGG + Intronic
945305192 2:208253724-208253746 ACACTGTATTAAAAGAAACAAGG + Intronic
945397744 2:209340935-209340957 ACACTGAGAAACAAGAAACAAGG + Intergenic
945489259 2:210435662-210435684 ACAAGGTTATTCAAGAAGAAAGG + Intronic
945969102 2:216218976-216218998 ACATTGTTATTCCACACACAAGG + Intergenic
946289704 2:218735199-218735221 ACACTGTTAATCAGAATACAAGG + Intronic
946455187 2:219819779-219819801 ACACTGCAATTCAAAAAAAAAGG - Intergenic
946593012 2:221272397-221272419 ACACTGTTGTTCAGGAATCAAGG - Intergenic
946918274 2:224549350-224549372 ACATTTTTATTCAAAACACATGG + Intronic
947684193 2:232067878-232067900 ACACAGTGATTCAAGAAAAAAGG - Intronic
948681985 2:239641254-239641276 ACTCTGTTCTGCAGGAAACAGGG + Intergenic
1169057026 20:2631502-2631524 AAACTGTTCTTCAAGAATGAAGG - Intronic
1169570083 20:6896868-6896890 AAACTATTATTTTAGAAACAAGG - Intergenic
1170196870 20:13698031-13698053 ACAATTTTATTGTAGAAACAGGG + Intergenic
1170404225 20:16019568-16019590 ACACAGTTATTCAGGAACCCAGG + Intronic
1170834016 20:19868341-19868363 ACCCTGTTACTCAAGCCACATGG - Intergenic
1171098658 20:22359564-22359586 AAACTTTTATTCTAGATACAAGG - Intergenic
1172737587 20:37139375-37139397 ACAGTGTTATTGAAGACCCAGGG - Intronic
1177435448 21:21046154-21046176 ACACTGCTATATAAAAAACATGG - Intronic
1178712796 21:34934393-34934415 ACATTGTCATTCAGCAAACATGG - Intronic
1180114471 21:45690291-45690313 ACAGTGTTAGGCAAGAATCAAGG - Intronic
1181891999 22:26071347-26071369 ATACTGTTATCCCAGAAACAGGG + Intergenic
1182894111 22:33844689-33844711 ACACTCTTATTTTATAAACAAGG - Intronic
1183173185 22:36202928-36202950 ACTCTGCTATTGAAGAAAAACGG + Intronic
1184442716 22:44528021-44528043 ATAATGTAAGTCAAGAAACAAGG - Intergenic
950060020 3:10063071-10063093 AAAGTGTTATTCCATAAACATGG - Intronic
950722559 3:14894056-14894078 ACATTGTGATAAAAGAAACAAGG - Intronic
951032853 3:17902179-17902201 GCACTGTTATTCAAGACGCTAGG + Intronic
951495753 3:23324056-23324078 GCACAGTTATTCCAGAAACAGGG - Intronic
951862881 3:27273414-27273436 ACACTGTCAATCTACAAACAGGG + Intronic
952072104 3:29649695-29649717 ACATTGTCATTCATGAAACAAGG + Intronic
952545056 3:34410070-34410092 ACACTGTCAGACAAGAAACCTGG + Intergenic
953108711 3:39911392-39911414 AAACTGTTATTAAAGAAAGTGGG - Intronic
953581539 3:44161585-44161607 ATTCATTTATTCAAGAAACATGG - Intergenic
953802602 3:46037285-46037307 AAAATGTTATTTATGAAACAAGG + Intergenic
954341741 3:49959508-49959530 ACACTGTCTTTCAAAAAATAGGG - Intronic
955031468 3:55225460-55225482 ACAGTTTTTTTCAAAAAACAGGG + Intergenic
956067267 3:65410366-65410388 ACACTGATGGTCAAGTAACATGG + Intronic
957207616 3:77217851-77217873 AAACTGTTATTTCATAAACAAGG + Intronic
957826377 3:85450174-85450196 ACAGCGTTATTTAAGGAACATGG + Intronic
957901579 3:86500836-86500858 ACTCTATTATTCAAGAGTCATGG - Intergenic
958433981 3:94075478-94075500 TCACTTTTATTCAGGAAATAGGG - Intronic
958564353 3:95789144-95789166 ACACTGTGTTTGAAGAAACATGG - Intergenic
959887961 3:111524427-111524449 ACACTGATTTTTAGGAAACAGGG + Intronic
960016561 3:112896681-112896703 ACACTATGATACTAGAAACAAGG - Intergenic
960562349 3:119098444-119098466 ACAATTTTTTTCATGAAACAGGG + Intronic
960595988 3:119408641-119408663 ACAGTGGTATTAAAGAAACCTGG - Intronic
963146166 3:141997412-141997434 ACACTGCTGTTCAAGGAATAGGG - Intronic
964946281 3:162229038-162229060 ATATTATTATTCAAGAAACATGG - Intergenic
965606530 3:170502902-170502924 ATACTTTTATTTTAGAAACAAGG - Intronic
965915404 3:173840193-173840215 ATACTATCATTCAAGAAAAAGGG + Intronic
966050354 3:175609666-175609688 ACACTGTAATGAAAGAAAAAAGG - Intronic
966504788 3:180687483-180687505 ACAATTTTATTTAAGAAACAGGG - Intronic
966742255 3:183244684-183244706 ACACTGGGTTTCAAGAAACTGGG - Intronic
967986138 3:195096688-195096710 ACACAGTTATTTAACAAGCAAGG + Intronic
968324838 3:197804581-197804603 AAATTGTTATACCAGAAACAGGG + Intronic
969112025 4:4850248-4850270 AAAATGTCATTCAAGAAACCTGG + Intergenic
970631514 4:17952220-17952242 AGACGGTAATTCAAAAAACAGGG + Intronic
971718739 4:30216360-30216382 ACAGTGATGTTCAAGGAACAAGG - Intergenic
972026572 4:34386112-34386134 CCACTGTTATTAGAGGAACATGG + Intergenic
972431422 4:38986206-38986228 GCTCTGTTATTCCAGATACAAGG + Intronic
973735213 4:53864849-53864871 AGGCTGACATTCAAGAAACAAGG + Intronic
974926362 4:68303476-68303498 ACATTTTTTTTCTAGAAACAAGG - Intergenic
975212827 4:71721269-71721291 ACATTCATATTCAGGAAACATGG - Intergenic
976134266 4:81919180-81919202 ACACTATTATTCAAGATATATGG - Intronic
977155332 4:93566017-93566039 ACACAGTCATTCAGGGAACAAGG + Intronic
977262269 4:94812214-94812236 ATACTGTTATAGAAGAAGCAGGG + Intronic
977793572 4:101135463-101135485 ACACTGTTTTATAAGAAAAACGG + Intronic
978141935 4:105327773-105327795 ACCCTGTTATTTAACCAACATGG + Intergenic
978623941 4:110663412-110663434 AAACTGTTATTGAAAAAGCAAGG + Intergenic
978832733 4:113108647-113108669 ACTCTGTTTTTCAAGAAATTAGG + Intronic
979462048 4:120994925-120994947 ACAGTGATATTTAAGCAACAAGG - Intergenic
980190428 4:129518154-129518176 ACACTGTTACTCAAGTATAAAGG - Intergenic
980398256 4:132244344-132244366 ACACTGTTAATGAAGATTCATGG - Intergenic
981697191 4:147570773-147570795 AAACTGTTCTTGCAGAAACAGGG + Intergenic
981860224 4:149346300-149346322 TCACTGTAAACCAAGAAACACGG - Intergenic
982084908 4:151824521-151824543 ACACTTTTATTCCAGATCCAGGG + Intergenic
982399510 4:154951638-154951660 CCACTGGCCTTCAAGAAACAGGG + Intergenic
982460636 4:155665630-155665652 ACACTGTTATTCAAGAAACAAGG - Intergenic
984173218 4:176385439-176385461 AGACTGTGATACAAGTAACAAGG - Intergenic
984356154 4:178661703-178661725 AAACTATTGTTCAAGAAAAATGG - Intergenic
987124258 5:14796701-14796723 TCACTTTTATTCAGGAAATAGGG - Intronic
987448493 5:18052054-18052076 ACACTGTTCTTCTAGAAAGTTGG - Intergenic
988217759 5:28298507-28298529 ACACAGTTATTTAAGAATAATGG - Intergenic
988994244 5:36699169-36699191 ACACTGATAATGAAGATACAAGG - Intergenic
989321185 5:40135670-40135692 TGACTGTTATTAAAGTAACAAGG + Intergenic
989962111 5:50428808-50428830 AAACTTTAATTAAAGAAACAAGG + Intronic
990928790 5:61062131-61062153 ACACAGATACACAAGAAACATGG + Intronic
991926193 5:71707221-71707243 ACTTTGTTTTTCAGGAAACAAGG + Intergenic
994675194 5:102812090-102812112 ACAGTGTTATTCAAAACTCAGGG - Intronic
994730484 5:103485363-103485385 GCACTGTTGTCCAAGCAACAGGG - Intergenic
995016328 5:107313846-107313868 AAACTGTTCTTAAAGAAGCATGG + Intergenic
995995766 5:118296769-118296791 ACACTGATATACAAGGAATATGG + Intergenic
996339978 5:122426091-122426113 AAACTGTGAGACAAGAAACATGG + Intronic
998259946 5:140622588-140622610 GAACTGTTATTCCAGATACATGG + Intergenic
999633071 5:153591708-153591730 ATACTGTTATTTAAGAAGCAAGG + Intronic
999794203 5:154973118-154973140 ACACACTTATTTAAGAGACAGGG + Intergenic
999917804 5:156282573-156282595 ACAGTGTGAATAAAGAAACATGG + Intronic
1001373271 5:171228850-171228872 ACATTATTATTTTAGAAACAAGG + Intronic
1002474250 5:179454960-179454982 ACAGTATTATTCAAGGAACTTGG - Intergenic
1008464296 6:51813597-51813619 CCACTATTATTCAAGTAACCTGG + Intronic
1008802041 6:55380315-55380337 CCACTATTAATGAAGAAACATGG + Intronic
1009036146 6:58119312-58119334 TCACTTTTATTCAGGAAATAGGG - Intergenic
1009211965 6:60872931-60872953 TCACTTTTATTCAGGAAATAGGG - Intergenic
1010167885 6:72939045-72939067 AGACTGTATTTTAAGAAACAAGG + Intronic
1010596891 6:77774901-77774923 ACACTGTTATTTAAGAATCCTGG - Intronic
1011357621 6:86488990-86489012 ACAGTGATGTTCAGGAAACAAGG + Intergenic
1012157453 6:95837578-95837600 GCACAGGTATTCAAGAAGCAAGG - Intergenic
1012766897 6:103378170-103378192 ACACTGCTCTTCAACATACAGGG + Intergenic
1013355765 6:109344727-109344749 ACAATGTAATTCAATAAAAAAGG + Intergenic
1014158564 6:118139657-118139679 TTTCTGTTATTCCAGAAACATGG + Intronic
1014272799 6:119351743-119351765 ACCCTGTCATTTAAGAAATACGG - Intergenic
1015293830 6:131568246-131568268 CCAATGTTATCCAAGAAACATGG + Intergenic
1016727589 6:147392905-147392927 ACATTGTTATTAAAGGAACATGG - Intergenic
1017802948 6:157914775-157914797 ACACTGTTAAGAAAGTAACAAGG - Intronic
1020224574 7:6270490-6270512 ACACACTTATTCCAGAAACCTGG + Intronic
1020472951 7:8560365-8560387 ACACTCTAATTCTAGAAAAAAGG + Intronic
1021284541 7:18764014-18764036 AAACTTTTATTCATAAAACATGG + Intronic
1022333828 7:29404334-29404356 ACATTTTTATTCAATAAATATGG + Intronic
1023390634 7:39708244-39708266 ACACTGTTATTTAGGAAATCTGG - Intergenic
1024777265 7:52802016-52802038 ACACTTGTCTTCAAGAAGCAAGG - Intergenic
1026396588 7:69961341-69961363 ACACTCAAATTCAAGAGACAGGG - Intronic
1026655311 7:72251406-72251428 ACACTCTGTTTCAAGAAAAAAGG - Intronic
1028795648 7:94899607-94899629 ACAGTGTTAATCAATAAACTTGG + Intergenic
1029002162 7:97165833-97165855 ACACATTTATTAAAGAAAAAAGG - Intronic
1030295944 7:107927442-107927464 ACAATTTTTTTCAAGAAACAGGG + Intronic
1033807002 7:144965724-144965746 ACACTCTTATTCAAGAAGGAAGG - Intergenic
1033979230 7:147143002-147143024 TAATTGTTATTCAAGATACAAGG - Intronic
1034837302 7:154364405-154364427 ACTGGGTAATTCAAGAAACAAGG - Intronic
1038244014 8:25837419-25837441 CCACGGTAATTCAAGAAAAAGGG - Intergenic
1039643844 8:39257069-39257091 GTATTGTTATTCAAGGAACATGG - Intronic
1040139997 8:43898671-43898693 ACAGTGATTTTCAGGAAACAAGG + Intergenic
1040465088 8:47687635-47687657 CCACTGTAATTCAATAAACATGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040994577 8:53388997-53389019 ACAATGTGATTTCAGAAACATGG - Intergenic
1040995209 8:53394101-53394123 ACAATGTGATTTCAGAAACATGG + Intergenic
1042046404 8:64657256-64657278 AAACTGTTTTTCTAGAAAGAGGG + Intronic
1043790450 8:84460514-84460536 AAAATGTTCTTCAAGATACAAGG + Intronic
1043827348 8:84945518-84945540 AAACTGTCATTCAAGAATCCTGG - Intergenic
1044217745 8:89632693-89632715 ACACTGTTAAAAAAGAAACAAGG - Intergenic
1046862290 8:119106921-119106943 ACACTTTGATTTAAGAAAAATGG + Intergenic
1048226178 8:132588340-132588362 ACACTTTTATTTAAGAAGCCAGG - Intronic
1048588001 8:135793079-135793101 AGACTGTTTTTTAAGGAACAAGG - Intergenic
1050798861 9:9583460-9583482 ACAATGTCATTCATGAAAAAGGG - Intronic
1051242078 9:15068740-15068762 ACACTATTGTTGTAGAAACAAGG + Intergenic
1051379945 9:16446730-16446752 AGACTGTTACTGAAGAAAAAAGG - Intronic
1052667133 9:31508956-31508978 ACACTGTTATATAGGAAATAAGG - Intergenic
1052678837 9:31662359-31662381 ACAGTTTTTTTCAAGAAACGTGG - Intergenic
1054824339 9:69557121-69557143 ATACTATTATTCATAAAACATGG + Intronic
1054894412 9:70292034-70292056 AAGCTGTTATTCAAGAAAAATGG - Intronic
1054964041 9:71001693-71001715 TCACTGTAACTGAAGAAACATGG + Intronic
1055849304 9:80606591-80606613 ACACTGTTCTTCAAGATATCTGG - Intergenic
1056242096 9:84657903-84657925 AAGCTGATATTAAAGAAACAAGG + Intergenic
1056502989 9:87228932-87228954 ACATTGTTTTTCAAGAAAAATGG - Intergenic
1056792495 9:89635052-89635074 ACACTGCTTTTAAAGAAACTGGG - Intergenic
1056987846 9:91380677-91380699 ATGCTGTTATTCAAAAAAGAAGG + Intergenic
1058303987 9:103413506-103413528 AAACTGTCATTCTAGAAATAAGG - Intergenic
1059143906 9:111880055-111880077 AAGCTTTTATTCAAGAAAAATGG + Intergenic
1059503405 9:114776263-114776285 ACAGAATTATTCAAGAAACCAGG - Intergenic
1059856865 9:118408823-118408845 ACACTTTAAATCAATAAACAGGG - Intergenic
1187914605 X:24141773-24141795 AAAATGTTATTCAGGAAACAAGG + Intergenic
1188823533 X:34802743-34802765 ACAGTGATGTTCAAGGAACAAGG + Intergenic
1189109475 X:38272777-38272799 ACACTATCATTCAAGAACTATGG + Intronic
1190313615 X:49135095-49135117 ACACATTTATTCAAGAAAATAGG + Intergenic
1191792023 X:64981187-64981209 GAACTGTTATTCTAAAAACAGGG + Intronic
1193709302 X:84860131-84860153 ACTAGGTTATTCAAGAAAGAGGG - Intergenic
1193835029 X:86332264-86332286 ACACTGTTATTGAAGAATCAAGG - Intronic
1194008913 X:88534225-88534247 AAAGTGTTATTTATGAAACATGG - Intergenic
1194496044 X:94617719-94617741 AGACTGTTATAAAAGAAAAAGGG - Intergenic
1196120088 X:112040664-112040686 ACACAGTTTATCAAGAGACATGG + Intronic
1196406305 X:115366160-115366182 AAACTGGGATTCAAGAAACCTGG + Intergenic
1197988510 X:132292731-132292753 ACACAGTTATTCATGAAGCTAGG - Intergenic
1198376499 X:136045344-136045366 ACACTGTTGTTCAGAAAAGAAGG + Exonic
1199836523 X:151597538-151597560 ACAAGATTAATCAAGAAACATGG - Intronic