ID: 982463255

View in Genome Browser
Species Human (GRCh38)
Location 4:155697815-155697837
Sequence TCCACCTTGAAGGAAACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982463255 Original CRISPR TCCACCTTGAAGGAAACTTC TGG Intronic
903078944 1:20793681-20793703 GCCATCTTCAGGGAAACTTCAGG + Intergenic
905471675 1:38196785-38196807 TTCACCTTTAAGGAGACCTCAGG - Intergenic
906749158 1:48243114-48243136 TCCACAATGAAGGAAACATGAGG + Intronic
908715961 1:67069302-67069324 TACACCTTGGATGAAACTTGAGG - Intergenic
909069761 1:70980405-70980427 TCCACCAAGAAGGAAACTGAGGG - Intronic
912867990 1:113276306-113276328 TCTACCTTGAAAAAATCTTCAGG + Intergenic
912891194 1:113533419-113533441 TCCACCCTGAAGGAGACCCCAGG - Intronic
915055960 1:153130863-153130885 GCCACCTAGAAGCAAACTTCTGG + Intergenic
917322510 1:173798225-173798247 TTCACCTTCAAGAAAACCTCAGG + Intergenic
917618545 1:176771014-176771036 TCCAACTTGCAGTAGACTTCAGG - Exonic
920759600 1:208769648-208769670 TCCACCTGGATTGAAACATCTGG + Intergenic
921281483 1:213572130-213572152 TCCACCTTGAAACTCACTTCTGG - Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063032849 10:2253512-2253534 TCCAGCTAGAAGGAAGCTACTGG - Intergenic
1065795333 10:29302357-29302379 TACACCCTGAGAGAAACTTCAGG + Intronic
1070812099 10:79303505-79303527 TCCCCTTTGAAGGAGACTCCGGG + Intronic
1072368284 10:94737292-94737314 TCCACCTGGAGGGTAACTTCGGG - Intronic
1075571976 10:123552766-123552788 GCCACCTTGAAGGGCACTGCAGG + Intergenic
1075601266 10:123771261-123771283 TCCCCCTAGGAGGAAACTCCTGG + Intronic
1075644095 10:124086348-124086370 TCCTCATGGAAGGAAACATCTGG - Intronic
1078864419 11:15283324-15283346 ACCACCTTGAAGATAACTACTGG + Intergenic
1079223966 11:18588922-18588944 TCTTCCTGGAAGGAAACTTGGGG + Intergenic
1079955449 11:26857505-26857527 TTCACCATGAAGAAAACTTAGGG - Intergenic
1080907186 11:36557801-36557823 TCCAACTTGAACAAAACTTGAGG - Intronic
1082107764 11:48239019-48239041 ACCACAATGAAGGAAACTTCTGG - Intergenic
1086731678 11:90257512-90257534 TCCCTCATGAAGGAAACTTATGG + Intergenic
1087924615 11:103904923-103904945 TCCACTTTGGTGCAAACTTCAGG - Intergenic
1089140736 11:116281903-116281925 TCCACATAGAAGGAAACATCAGG + Intergenic
1089217846 11:116846412-116846434 TCCATGCTGAAGGAGACTTCGGG + Exonic
1090356040 11:126140887-126140909 TCCTCCTTGATGGGAACTTCGGG - Intergenic
1090607294 11:128434262-128434284 TCCACATTAAAGGAAACACCAGG + Intergenic
1090760120 11:129829218-129829240 TCCTCCTTAAAGGAAAATTTAGG + Intronic
1091218386 11:133917337-133917359 TCCACCTGGAAGGACACTCAAGG + Intronic
1096306866 12:50485365-50485387 CCCACCTTGAAGGAAATTATAGG + Intergenic
1097095180 12:56541877-56541899 TCTACATTGAAAGAAACATCTGG + Intronic
1100583788 12:95960538-95960560 TCCACGTTGAAGAATCCTTCTGG - Exonic
1101077061 12:101141391-101141413 TCCACCTGGATGGAAACATCAGG + Intergenic
1101577318 12:106009741-106009763 TCCATATTGAAGGAAACTAATGG + Intergenic
1103165249 12:118764939-118764961 ACCACCTGGAAGGAAATGTCAGG - Intergenic
1104044922 12:125155158-125155180 TCCCCCTTGATGGGAACCTCAGG + Intergenic
1109575789 13:64256190-64256212 TCCACCTTCAAGCAAAATTTTGG - Intergenic
1110052904 13:70926221-70926243 TCAACCTTGAAGGTAGCTTATGG - Intergenic
1110165887 13:72442643-72442665 TTCATCTTAAAGGAAATTTCAGG + Intergenic
1117526971 14:56618261-56618283 TCCATGTGGAAGGAAACATCAGG + Intronic
1118492728 14:66277343-66277365 TACACCTTGAAGGAATCATCAGG - Intergenic
1121560184 14:94868755-94868777 TCAACTTTGAAAGAAACTCCAGG + Intergenic
1122006320 14:98706776-98706798 TACAACATGAATGAAACTTCAGG - Intergenic
1122016872 14:98803742-98803764 GCCACCTTGCAGGAATCATCAGG - Intergenic
1123951161 15:25277379-25277401 AACAACTTCAAGGAAACTTCAGG + Intergenic
1126303188 15:47222955-47222977 ACCACACTGAAGGAAACTTAAGG + Intronic
1128150755 15:65362249-65362271 TCCACCTAGGAGGAAACTAGAGG + Intronic
1128550006 15:68591828-68591850 TTTTCCTAGAAGGAAACTTCTGG - Intronic
1134113964 16:11534267-11534289 TGCTCCTGGAAGGAAACTCCAGG + Intergenic
1134299917 16:12981536-12981558 TCAACCTTGAAGGAATTTCCAGG - Intronic
1136118510 16:28112154-28112176 TCCAACTGGAAGGCAACTTAGGG + Intronic
1138585157 16:57964519-57964541 TCCTCCTTGAATGACTCTTCGGG + Exonic
1139249436 16:65480807-65480829 TCCACCTTGCAGCAAAGATCAGG + Intergenic
1140950676 16:79814219-79814241 GCTACCTTGCTGGAAACTTCAGG + Intergenic
1141495220 16:84405110-84405132 TCCACCTGGAAGGAGAGGTCAGG - Exonic
1142358338 16:89614460-89614482 TCCACCTGGAAGGAAATTGTGGG - Intronic
1146429845 17:32782114-32782136 TCCAGCTTAAAGGAAATTTAAGG - Intronic
1149526957 17:57364009-57364031 CCCACCTAGAAGGAAAATGCAGG - Intronic
1150376035 17:64682359-64682381 TGCACATGTAAGGAAACTTCAGG + Intergenic
1151303657 17:73248526-73248548 TGCACCTTGCAGGAAGATTCGGG - Exonic
1151596094 17:75078774-75078796 ACCACCTTGAAGGAAAAACCGGG - Intergenic
1155083545 18:22433206-22433228 TCCCCCTTGCAGGTCACTTCAGG - Intergenic
1155362163 18:25014594-25014616 TCCAAATGGAAGGAAACCTCTGG - Intergenic
1156350890 18:36300019-36300041 TCCACCTTGATAGAAACAGCTGG + Intronic
1156789257 18:40952051-40952073 ACTACCTTTAAGGACACTTCAGG - Intergenic
1158514134 18:58116998-58117020 TCCATCTAGAAGGGAATTTCAGG + Intronic
1159668276 18:71190912-71190934 TCCACATCGAAGGAAACATCAGG + Intergenic
1163389275 19:17020524-17020546 GCCAGCTTGGAGGAAACCTCTGG - Intronic
1164546004 19:29163462-29163484 TCCGCCTTGAAGGAATTTACAGG - Intergenic
1165520828 19:36312523-36312545 TACGGCTTGAAGGAAACTTCTGG + Intergenic
1165523826 19:36335252-36335274 TATTCCTTGAAGCAAACTTCTGG + Exonic
1165623244 19:37266062-37266084 TACGGCTTGAAGGAAACTTCTGG - Intergenic
1165635087 19:37333930-37333952 TGCGGCTTGGAGGAAACTTCCGG - Intronic
1165820923 19:38675556-38675578 TCCCTCTTGAAAGAAATTTCTGG - Intronic
1168592229 19:57646877-57646899 TCCACCATGAAGGAATCTCCAGG - Intergenic
925292210 2:2755499-2755521 TCCACCATGCAGGAAGCTTTGGG + Intergenic
927225689 2:20764049-20764071 TCCACTTTGAAAGCAATTTCAGG + Intronic
927265542 2:21145122-21145144 TCCACATGGAAGGAAACATCAGG + Intergenic
928586076 2:32759886-32759908 TACAACATGAAGGAACCTTCAGG - Intronic
929459241 2:42089791-42089813 TCCACCTTAAAAGCATCTTCTGG + Intergenic
931072950 2:58674718-58674740 TCAACCTTGATGTAAACATCTGG + Intergenic
934963017 2:98694253-98694275 TCCACCTGGAAGGACATTTTGGG + Intronic
940134695 2:150423108-150423130 TCCATATGGAGGGAAACTTCAGG + Intergenic
941087441 2:161134329-161134351 TCCCCATTTAATGAAACTTCTGG - Intergenic
943861617 2:192872152-192872174 TCCACATTGAAGGCAATATCAGG + Intergenic
943965158 2:194322576-194322598 TCCACCTTAGAGAAGACTTCAGG + Intergenic
944840950 2:203623205-203623227 TCCAACTGGCAAGAAACTTCAGG + Intergenic
945229685 2:207572858-207572880 TCCACCTGGAAGGGTACTTGCGG - Intronic
947264833 2:228267013-228267035 TACACCTGAAAGGAAACATCAGG + Intergenic
947444661 2:230154803-230154825 TCCTCCTCCAAGGAAACTTTTGG - Intergenic
948106502 2:235418598-235418620 TCTACCTAGAAGAATACTTCAGG + Intergenic
1170077325 20:12433879-12433901 ACCACCTGGAAGGAAATTCCAGG - Intergenic
1172092338 20:32442522-32442544 CCCACCTTGAAGGAAACAAAAGG - Intergenic
1173892639 20:46525028-46525050 TTCACAGTGAAGGAAGCTTCTGG + Intergenic
1178618749 21:34156244-34156266 TGGAACTTGAAGGAAGCTTCTGG - Intergenic
1179316837 21:40251429-40251451 TCTACGTAGAAGGAAACATCGGG - Intronic
949580037 3:5378509-5378531 TCCACCTTGTAGCAAAGGTCTGG + Intergenic
950063700 3:10093797-10093819 TCCACTTGGAAGGAAACTTGAGG - Intronic
951050606 3:18089147-18089169 TAGACATTTAAGGAAACTTCAGG + Intronic
954904144 3:54045360-54045382 TCCACATTGAATTAAGCTTCTGG - Intergenic
959438084 3:106342175-106342197 TCCACATTGAAGAATAATTCTGG + Intergenic
960215484 3:115030694-115030716 TGTACCCTGAAGGAAGCTTCTGG - Intronic
961660710 3:128467517-128467539 TCCATCGTCATGGAAACTTCAGG - Intergenic
963080534 3:141389167-141389189 TTCACATTGAAGCAAACCTCGGG - Intronic
963236457 3:142962177-142962199 TCCGCCTTGGAGGAGACTACTGG - Exonic
964919871 3:161883848-161883870 TCCACCAGGATGGAAAATTCAGG - Intergenic
967219091 3:187234403-187234425 TCCAGCTAGAAGGAACCTGCAGG + Exonic
969428863 4:7141283-7141305 TCCAGCTTGAAGGAAAAGGCTGG + Intergenic
971253671 4:24994408-24994430 TCCACAGGGAAGGAAACATCAGG - Intergenic
971445711 4:26745837-26745859 TCTACCTTCAAATAAACTTCAGG + Intronic
974570249 4:63637029-63637051 TCCACCAGTAAGAAAACTTCCGG - Intergenic
974859442 4:67501495-67501517 TCCATGTTGAAGGAAACTAAGGG + Intronic
974965500 4:68756030-68756052 TCTACTTTGATGGAAATTTCTGG - Intergenic
978700170 4:111633640-111633662 TCCCCCTTAAAGGAAAATTTCGG - Intergenic
979236022 4:118401221-118401243 TCCACTTTTAAGGAATCTTGTGG - Intergenic
979573772 4:122262002-122262024 TCTACCTGGAAGGAAACTAGAGG - Intronic
982463255 4:155697815-155697837 TCCACCTTGAAGGAAACTTCTGG + Intronic
982844515 4:160232853-160232875 TCCACCTAGAAGGAAGTTTGGGG + Intergenic
982972881 4:162013344-162013366 TCCATATAGAAGGAAACATCAGG - Intronic
982989406 4:162252174-162252196 TTCATCTTGAAGAAAATTTCAGG + Intergenic
987312240 5:16692118-16692140 TCCACTTATAAGGAAACTGCAGG + Intronic
988103255 5:26709136-26709158 AACTCCTTGAAGGAAACTTTGGG + Intergenic
988871097 5:35390970-35390992 TGCAGCTTGAACAAAACTTCAGG - Intergenic
993718296 5:91296846-91296868 TCCACCCTCAAGCTAACTTCTGG + Intergenic
994727798 5:103456731-103456753 TGCACCTTGAAGGATAGTTAGGG - Intergenic
995191867 5:109326452-109326474 TCCATGTGGAAGGAAACATCAGG + Intergenic
995902740 5:117089391-117089413 AACAGCATGAAGGAAACTTCTGG + Intergenic
998593352 5:143501372-143501394 GCCTCCTGGAAGGAGACTTCTGG - Intergenic
998799470 5:145854761-145854783 CCCTCCTTGAAGGACACTTGTGG - Intergenic
999716640 5:154366402-154366424 TCCAGTTTAAAGGAAAATTCAGG - Intronic
1002103297 5:176867942-176867964 TCCAGCCTGGAGGAAACTCCAGG - Intronic
1003164081 6:3661067-3661089 TGCACCTTGAGGGAAGCTGCAGG - Intergenic
1003380153 6:5617617-5617639 TCAACTTTTAAAGAAACTTCTGG - Intronic
1004922149 6:20385784-20385806 TCAGCTTTGAAGGAAACTCCAGG - Intergenic
1005463581 6:26091161-26091183 TGCATCTTGAAGGAAACAGCTGG + Intronic
1006427695 6:33976463-33976485 TCCTCCTTGCTGGAACCTTCTGG - Intergenic
1008144841 6:47878783-47878805 TCCACCCTCTGGGAAACTTCTGG - Exonic
1009338645 6:62526293-62526315 TCATCCTTGAAGAAATCTTCTGG + Intergenic
1010266794 6:73876808-73876830 TCCATCTGGAAGGAAACAACAGG + Intergenic
1010383110 6:75246911-75246933 TCTACTTTGAAAGTAACTTCTGG - Intronic
1010717391 6:79245371-79245393 TCCCTCTTTAAGGCAACTTCCGG + Intergenic
1012415042 6:99004106-99004128 TCCACCTGGAAGGAAACATCAGG - Intergenic
1013040361 6:106426849-106426871 TCAACATGGAAGGAAACATCAGG + Intergenic
1014936551 6:127392215-127392237 TAGAGCTAGAAGGAAACTTCTGG + Intergenic
1015218931 6:130782124-130782146 TCCACCTTGAAAGTCACCTCAGG + Intergenic
1016175579 6:141074647-141074669 TCCACATCGAGGCAAACTTCTGG - Intergenic
1023150020 7:37193362-37193384 TCCATCTTAAAGGAGAGTTCTGG - Intronic
1023263650 7:38382451-38382473 TCCACATTCAAGGACATTTCTGG + Intergenic
1023365101 7:39456206-39456228 GCCACCTTGATGGGAACTTCAGG - Intronic
1023581260 7:41686093-41686115 TCTACCTTTAAGGAGACTGCAGG + Exonic
1024807122 7:53155673-53155695 TGCAACTTGGAGGAAACTTGAGG + Intergenic
1026036242 7:66832470-66832492 TCCTCCTTGCAGGAACCTCCGGG - Intergenic
1026983250 7:74538668-74538690 TCCTCCTTGCAGGAACCTCCGGG + Exonic
1028134415 7:87210801-87210823 TCCCCCTTGCAGCAGACTTCTGG + Intronic
1029649544 7:101881771-101881793 TCCACCTTCAAGGAGGTTTCTGG - Intronic
1032110004 7:129068017-129068039 ACCACCCTGAAGTATACTTCAGG - Intergenic
1032955915 7:136972278-136972300 TCTACCTTGAGGGAAATTTCTGG + Intronic
1033007826 7:137586591-137586613 TCCACAATGAAGCCAACTTCAGG - Intronic
1033013515 7:137647545-137647567 TCCACCTGGATGGACAATTCTGG + Intronic
1034248248 7:149665755-149665777 TCCACCTTGCAGGAAGAGTCAGG - Intergenic
1036622400 8:10432976-10432998 TTCACCTGGAAGGAAAGCTCTGG - Intergenic
1041082939 8:54230614-54230636 TTCTCCTGGAAGAAAACTTCCGG - Intergenic
1043347317 8:79314265-79314287 TCCACCATGAAGGAATGTTTAGG - Intergenic
1045242432 8:100414400-100414422 TGCATCTTGAAGTAAACCTCGGG + Intergenic
1045535595 8:103024350-103024372 TCAACCTAAAAAGAAACTTCAGG + Intronic
1047032324 8:120896202-120896224 TCCACCTGGAAGCAGACTCCGGG + Intergenic
1047645171 8:126862662-126862684 TCAACTATGAAGGAAACTTCTGG - Intergenic
1049244718 8:141556194-141556216 CCCACCTGGAAGGAAACTCGAGG - Intergenic
1049404091 8:142443922-142443944 CCCACCTTGGAGGAAGCCTCAGG + Intergenic
1052897686 9:33763116-33763138 TCCTCCTTAAAGGAAAATTTAGG + Intronic
1055275103 9:74606513-74606535 TCTACCTTGTAAGATACTTCAGG + Intronic
1055749262 9:79486714-79486736 TCCACATAGAAGGTAACATCAGG - Intergenic
1057334433 9:94144669-94144691 ACCACCTTGCTGGAGACTTCTGG - Intergenic
1186252848 X:7687666-7687688 TCCACCATGAAGGATACTCTAGG - Intergenic
1186407779 X:9318764-9318786 CCCACCTGGAAGGAAAACTCAGG - Intergenic
1186478441 X:9877496-9877518 TGCTCCTTGCAGGAAAGTTCAGG + Intronic
1187495299 X:19790085-19790107 TCCACCTTCCAGGACACTTCAGG + Intronic
1188373455 X:29397695-29397717 TCCCCCTTGAAGCAATCATCAGG - Intronic
1193154558 X:78158691-78158713 TCCACCTGGAAAGAGACTTGGGG + Intergenic
1197186564 X:123593733-123593755 TTCACCTTCAAGGAACCATCTGG + Intergenic
1199243886 X:145579997-145580019 TACACCTTGAAGGGCACTTCAGG - Intergenic
1199297419 X:146174849-146174871 TCCACTTTCAAGGACACTTGTGG + Intergenic
1200919967 Y:8604469-8604491 TCCACTTTGAAGGAGGCTTTGGG + Intergenic
1202034885 Y:20621949-20621971 ACCACCTTGAAAGAAGCTTCTGG - Intergenic