ID: 982469129

View in Genome Browser
Species Human (GRCh38)
Location 4:155765420-155765442
Sequence CATTTCCTCTTTAACGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982469129 Original CRISPR CATTTCCTCTTTAACGAACA AGG (reversed) Intronic
902906248 1:19559992-19560014 CATTTCTTCTTTAATAAATAAGG - Intergenic
908211781 1:61907467-61907489 CATTTCCTCTTGACCGTCCAAGG + Intronic
908396505 1:63730197-63730219 CAATTCCTCATAAAAGAACAGGG - Intergenic
908463675 1:64370429-64370451 CTTTTCCTCTTAATCAAACAGGG + Intergenic
909201025 1:72690232-72690254 CTTTTCATCTTTAAAGAATACGG + Intergenic
909201273 1:72692893-72692915 CTTTTCATCTTTAAAGAACATGG - Intergenic
911542329 1:99172789-99172811 AATTTCTTCTTTATCAAACAGGG + Intergenic
912888718 1:113504172-113504194 GATTTCCTGTTTAATCAACAGGG - Intronic
915359635 1:155278126-155278148 GATTTCCTCTTTCAGGAACCCGG + Intronic
917734082 1:177904658-177904680 CATTTCCTCTATAAGGCTCAGGG + Intergenic
919672710 1:200352315-200352337 CATTTCCTATTTATGCAACATGG + Intergenic
1064346235 10:14534995-14535017 CATTTCCTCTCTGAGCAACAAGG + Intronic
1068672311 10:59735686-59735708 CATTTCCGCTTTATCTCACAGGG - Intronic
1069592095 10:69648588-69648610 CATTTCCTTTTTATGGAACCTGG + Intergenic
1071181689 10:82992369-82992391 CATTTCCTCTTTATTAAACAGGG + Intergenic
1071206801 10:83289472-83289494 CAATTCCTCCTTAACGAATTGGG - Intergenic
1071764696 10:88649756-88649778 TATTTTCTCTTTAAAGAAGAGGG + Intergenic
1072496560 10:95966933-95966955 CATATCCTCTTTAAGGGAGATGG - Intronic
1077610246 11:3639529-3639551 CATTTCCCCTTTAACCAAGTGGG + Intronic
1080425510 11:32150535-32150557 CCTTTCCTCTGTAAGGACCAAGG - Intergenic
1080760527 11:35244770-35244792 GATCTCCTCTTTACCGTACATGG + Intergenic
1081301352 11:41456422-41456444 CTTTCCCTCTGTAACAAACAGGG - Intronic
1086195410 11:84132910-84132932 CATTTCCTGTTTAAGACACATGG - Intronic
1088006433 11:104946265-104946287 CATTTTCTCTTTAAACAAGAGGG + Intronic
1091848914 12:3679401-3679423 GATTTCTTCTTTAAGCAACAAGG + Intronic
1092640856 12:10507365-10507387 CAATTTCTCTTTAACAACCAAGG + Exonic
1095551969 12:43453053-43453075 CATTTCCTTTTTATTTAACATGG - Intronic
1096406171 12:51345989-51346011 CAGTTCCTCTCTAACGAATGAGG + Intronic
1099675052 12:85748445-85748467 CATTTCCTCATCTACGAAAATGG + Intergenic
1102374588 12:112411766-112411788 CATTTACTTTATAACTAACATGG - Intronic
1103731358 12:123029892-123029914 CATATCCTCTTTAGTGCACATGG - Intronic
1104338141 12:127920108-127920130 TTTTTCCTCTTTAAAGAGCAAGG + Intergenic
1105623352 13:22089919-22089941 CAGTTCCTTTTTACCAAACAGGG + Intergenic
1106034431 13:26030950-26030972 CATTTCCTCTATAACTGAAATGG + Intergenic
1106691017 13:32116746-32116768 CATTTGTTCTTTAAAGAAAAAGG + Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1108576522 13:51796074-51796096 CATTTCCTCATTAAAAAATAGGG - Intronic
1109040629 13:57331165-57331187 CATTCCCTCTTTCTCGGACATGG + Intergenic
1109185519 13:59263266-59263288 CATTTTCTCTTTATGAAACAGGG - Intergenic
1113993497 14:16048290-16048312 CTTTTCCCCTTTCACGAAGAAGG + Intergenic
1116433004 14:44867846-44867868 CATTTCCTTCTTTAGGAACAGGG - Intergenic
1117434877 14:55706412-55706434 TAGTTCCTCTTTAACCACCAGGG + Intergenic
1117459570 14:55931639-55931661 CATTTCTTCTTTAAAAAAAAAGG - Intergenic
1118078713 14:62332368-62332390 CATTTACTCTTTGATAAACATGG + Intergenic
1120685747 14:87534668-87534690 CCTTTTCTCTTTAACTAATAAGG - Intergenic
1121361947 14:93269791-93269813 CCTTTCCTCTTTAGGGAACTGGG + Intronic
1127139176 15:55956279-55956301 CTTTTCTTCTTTAAGAAACAAGG - Intronic
1127991471 15:64121498-64121520 CATTCCCTCTTTAACAAATAAGG + Intronic
1128211665 15:65907746-65907768 CTTTTCCTTTTTACAGAACAGGG + Intronic
1131503607 15:92995943-92995965 CATTTTTCTTTTAACGAACAAGG + Intronic
1133633771 16:7646863-7646885 CTCTCCCTCTTTTACGAACATGG - Intronic
1133707864 16:8372502-8372524 GATTTCCTCTTTGAAGAAAATGG + Intergenic
1135411585 16:22238986-22239008 CATTTCCTTGTTTACAAACAAGG - Intronic
1136463938 16:30429311-30429333 CATTTCCTCTTTCCGGAACTTGG + Intronic
1137770284 16:51010931-51010953 CATTTCCACTTTATCAAGCAGGG - Intergenic
1138293999 16:55871508-55871530 CATTTCCCTTTTACCCAACAGGG + Intronic
1138409852 16:56830360-56830382 CTTTTCCTGTTTTACAAACAAGG - Intronic
1139934595 16:70560106-70560128 CATTTCCTCTTAAAGGAACAAGG - Intronic
1149691422 17:58580177-58580199 CATTTCCTTTTTTTCAAACAAGG + Intronic
1155848976 18:30746669-30746691 CATTTCCTCTTTTACAAAAAGGG - Intergenic
1156019553 18:32584081-32584103 CAGTTCCTCATTTAGGAACAAGG + Intergenic
1156511563 18:37641175-37641197 CTTTCCCTCTTTGACGAAAAGGG - Intergenic
1157785878 18:50482177-50482199 CATTTCCTTTTCAAGGGACATGG - Intergenic
1159867812 18:73727079-73727101 TCCTTCCTCTTTAAAGAACATGG + Intergenic
1161832443 19:6616778-6616800 GAGTTCCACTTTAGCGAACACGG + Intergenic
1167962734 19:53120656-53120678 TATATCCTCTTTAATGAAAAAGG + Intronic
928075486 2:28260767-28260789 CATTTTCCCTTTCATGAACATGG + Intronic
932010260 2:67970478-67970500 CCTTTCCTTTTTAAAGAAAATGG + Intergenic
933816450 2:86072717-86072739 CATTTCCTCTTTTATTTACAAGG + Intronic
934110279 2:88735800-88735822 CATTTCCTCTTTCACAAAAATGG - Intronic
940258145 2:151754051-151754073 CCTTTCCTCTTAAGTGAACAAGG + Intergenic
940519916 2:154732026-154732048 CATTTCCTCATTTACAAATATGG - Intronic
943780987 2:191823641-191823663 CTTTTCCTTTTTTATGAACATGG - Intergenic
945499985 2:210560231-210560253 CATTTATTCTTTAATAAACACGG + Intronic
1170470839 20:16666441-16666463 CATTTCCTATTTAACGTAGCTGG + Intergenic
1171118914 20:22551124-22551146 CATTTCCACTTTACAGAAGAGGG - Intergenic
1178187686 21:30242418-30242440 CATTTCATGTTGAAGGAACAAGG + Intergenic
1180313772 22:11259223-11259245 CTTTTCCCCTTTCACGAAGAAGG - Intergenic
1181592447 22:23893836-23893858 CCTATCCTCTTTAAAGAGCAGGG + Intronic
1181864883 22:25847122-25847144 CATTTCCACTATAACGCACTAGG - Intronic
1184433104 22:44453198-44453220 CCTTTCCACTGTAACGGACAGGG + Intergenic
1184609894 22:45596188-45596210 AATTTCCTCTTCTATGAACAGGG - Intronic
951441637 3:22730325-22730347 TATTTCATATTTAACCAACAGGG + Intergenic
951989383 3:28658894-28658916 CATTTTCTCACAAACGAACAGGG - Intergenic
955515732 3:59724716-59724738 CAGTTCCTCTTCAAAGAACATGG + Intergenic
957599117 3:82309156-82309178 CTTTTCCACTTAAACAAACAAGG + Intergenic
958684985 3:97380603-97380625 CATTTACTCTTAAAGGAAAAAGG + Intronic
959808213 3:110584289-110584311 TATTTCCTCTATAAGGAATAAGG - Intergenic
960626418 3:119686208-119686230 CATTTCATCTTTAACTCAAAAGG + Intergenic
966498068 3:180602724-180602746 CATTCCCTCATTAACCAACCTGG - Intronic
967703995 3:192628999-192629021 CATTTCCTCTCTCTGGAACATGG + Intronic
971734584 4:30430334-30430356 CAATTCCTCTTTCATGAATAGGG - Intergenic
972043668 4:34637289-34637311 CATTTCCTCTGAAAGGGACAAGG + Intergenic
974584468 4:63854352-63854374 CATTTTCTCTTTAATGACCTGGG + Intergenic
977530407 4:98194146-98194168 TATTTATTCTTTAACGAAAAGGG + Intergenic
978359513 4:107914761-107914783 AATTTCCTCTTTATCAAAAAAGG - Exonic
979369012 4:119861358-119861380 CATTTCCTCTTCTACAACCATGG - Intergenic
981551729 4:145948262-145948284 CATATCCTCTTTTACCAACAGGG + Intergenic
982469129 4:155765420-155765442 CATTTCCTCTTTAACGAACAAGG - Intronic
982729985 4:158945476-158945498 CATTTCCTTTTCATCGAACATGG + Intronic
983188417 4:164727824-164727846 CATTTCAGCTTTAACAAATATGG - Intergenic
987673602 5:21045845-21045867 CATATTCTCTTAAACGACCATGG + Intergenic
987800034 5:22683682-22683704 AATTTCTTCTTTAGCGAAAAAGG - Intronic
988197326 5:28021252-28021274 AATTTCCTATTTAACAAAAAAGG - Intergenic
990609112 5:57440187-57440209 CATTTCCTATATAACAAAGATGG - Intergenic
990825712 5:59894917-59894939 CATTTCATCTTTAAGTAATATGG - Intronic
991484417 5:67119562-67119584 CATTTAATCTTTTACAAACAGGG - Intronic
993326259 5:86541663-86541685 CATTTTCTCTTGAATGAAGATGG + Intergenic
993781547 5:92072222-92072244 CTTTTCTTTTTTAATGAACACGG + Intergenic
994151449 5:96452328-96452350 CATGTCCTTTTTCACGGACATGG + Intergenic
995004009 5:107169189-107169211 CATTTCCTCTTTATCTGACTTGG + Intergenic
998315907 5:141182951-141182973 CATTTCCTTTTCAGTGAACATGG - Exonic
999783547 5:154870648-154870670 CATGTCCTCTCTAAAAAACAAGG - Exonic
999933940 5:156464723-156464745 CTCTTCCCCTTGAACGAACATGG + Intronic
999957515 5:156718669-156718691 CATTTCATCTTTAAAGCACTTGG - Intronic
1006988795 6:38195150-38195172 CATTTCCCCTTCAAGCAACATGG - Intronic
1009656300 6:66549511-66549533 AATTTACTCTTTCACCAACAGGG - Intergenic
1010776158 6:79888337-79888359 CATTTCTTCTCTATCGAACCAGG + Intergenic
1011898615 6:92263381-92263403 CATTTGCTCCTTAATGAAGATGG + Intergenic
1012875887 6:104725621-104725643 GTTTTCCTCTATCACGAACAAGG + Intergenic
1013564076 6:111339459-111339481 CATTTCCTCACTAACAAAAATGG + Intronic
1013605257 6:111741572-111741594 CTTTTCCCTTTTAAAGAACATGG + Intronic
1013951193 6:115783902-115783924 TATTTCCTCTTTAAGGAAATGGG - Intergenic
1016290603 6:142524938-142524960 CTTTTCCTTTTTAAAAAACAAGG - Intergenic
1016809112 6:148242846-148242868 CATTTCTTCCTTAAGGACCATGG + Intergenic
1018764387 6:166921611-166921633 CATTTCCTTTTTGAGCAACAAGG - Intronic
1019490144 7:1308815-1308837 CATTTCCTCCTAAAAAAACAAGG - Intergenic
1021384584 7:20012522-20012544 CATATCCCCTTTAAGGAATATGG - Intergenic
1022437512 7:30403860-30403882 CATGTCCTCCTTGACCAACAGGG - Intronic
1026426042 7:70294812-70294834 CATTTCCTATTTAACGGAGAAGG - Intronic
1028167545 7:87555566-87555588 AATTTCATCTTTAGTGAACACGG - Intronic
1032998291 7:137474054-137474076 CACTTCTTCTTAAAGGAACAAGG - Intronic
1036140045 8:6199237-6199259 TTTTTCCTCATTAAAGAACAAGG - Intergenic
1036632344 8:10524609-10524631 CATTTCATCTTGAATGCACAGGG + Intergenic
1038857455 8:31349032-31349054 CATTTCCCCTGTAACAATCAAGG + Intergenic
1040427521 8:47303781-47303803 CATGTCATCTTTGATGAACAAGG - Intronic
1040939720 8:52819782-52819804 CATTTCATCTTTAAGTATCATGG - Intergenic
1042373121 8:68015689-68015711 CATTTGCTCTTAAAATAACATGG - Intronic
1042425032 8:68637774-68637796 CATTTCCACTTGAACTTACATGG - Intronic
1042672985 8:71284342-71284364 CATATCCTCTCTAACTTACAGGG + Intronic
1045661968 8:104447489-104447511 CATTTCTTCTTTAACCTAAAAGG + Exonic
1045998395 8:108390476-108390498 GATTTCCTCTTTATAGAACTGGG - Intronic
1050187238 9:2987357-2987379 CCATTCCTGTTTAAGGAACAGGG - Intergenic
1050429237 9:5544925-5544947 CATATCCTTTTTAAAGAACGTGG + Intronic
1052334238 9:27303559-27303581 TATTTGCTGTTTAAGGAACAGGG - Intergenic
1055673823 9:78634802-78634824 CATTTCCTGTGTAAGCAACAGGG + Intergenic
1056508884 9:87283853-87283875 CATTCCCTCTATCAGGAACAGGG + Intergenic
1057988271 9:99740381-99740403 AATTCCCTCTTTAAGGGACAGGG + Intergenic
1185703475 X:2249065-2249087 CATTTCCACTGTGAAGAACATGG + Intronic
1186755744 X:12669689-12669711 CACTTCCTCTTTAACTTAAAAGG - Intronic
1190825877 X:54017556-54017578 CATTTCCTCTGTAACCATCTTGG - Intronic
1192115146 X:68403146-68403168 CTTTTCCTATTTAACACACAGGG - Intronic
1193257259 X:79364598-79364620 GATTTACTCTTTAATGATCAGGG - Intronic
1197896770 X:131324426-131324448 CATTTACACCTTAAGGAACAAGG - Intronic
1198152528 X:133924940-133924962 CTTTTCCTCTTTAAGGAATATGG - Intronic
1198716448 X:139562669-139562691 CATCTCTCCTTTAACGACCATGG - Exonic
1198827188 X:140712081-140712103 CATTTTCTCTTTACCCAAGATGG + Intergenic
1202017130 Y:20421392-20421414 CAGTGCCTCTTTCACTAACATGG + Intergenic
1202575529 Y:26320556-26320578 TATTTACTCTTCAACGATCACGG + Intergenic