ID: 982469377

View in Genome Browser
Species Human (GRCh38)
Location 4:155769055-155769077
Sequence TTGGAGAAGATGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1157
Summary {0: 1, 1: 0, 2: 13, 3: 96, 4: 1047}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982469377_982469380 1 Left 982469377 4:155769055-155769077 CCTTCTTCCTTCATCTTCTCCAA 0: 1
1: 0
2: 13
3: 96
4: 1047
Right 982469380 4:155769079-155769101 TACTATAACTTACCAGTTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 97
982469377_982469381 11 Left 982469377 4:155769055-155769077 CCTTCTTCCTTCATCTTCTCCAA 0: 1
1: 0
2: 13
3: 96
4: 1047
Right 982469381 4:155769089-155769111 TACCAGTTAGAGGAAGTATCAGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982469377 Original CRISPR TTGGAGAAGATGAAGGAAGA AGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900500069 1:2999989-3000011 TGGGAGAGGATGGAGGAAGCTGG + Intergenic
900975127 1:6011970-6011992 GTGGAGGTGATGAAGGCAGAGGG + Intronic
901212585 1:7534905-7534927 TTGAAAAAGATGCAGAAAGAAGG + Intronic
901227806 1:7624540-7624562 GTGGAAGAGATGAAGGGAGAGGG + Intronic
901336828 1:8456669-8456691 ATGGAGAAGATGAAGTCGGAAGG - Intronic
901411550 1:9087829-9087851 AGAGAGAAGAGGAAGGAAGAGGG - Intronic
902079166 1:13809364-13809386 TGGTAGAAGAGGAAGGAAGGCGG + Intronic
902275737 1:15338056-15338078 CTGGAGTAGATGATGGGAGAGGG - Intronic
902688221 1:18092807-18092829 TAGAAGAAGATGAAGTATGAAGG - Intergenic
902743824 1:18459673-18459695 CTGGAGAAGAGAAAGAAAGAGGG - Intergenic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903613438 1:24633868-24633890 TTGGAGATGGTGAAGGGACAGGG + Intronic
903622442 1:24707755-24707777 TTGGAGAAAATCAAGCAAAAAGG + Intergenic
903698501 1:25228161-25228183 GTGCAGAAGATGCAGAAAGATGG - Exonic
903788161 1:25875108-25875130 TTGGAGAAAATGAAGGATGGAGG - Intergenic
904213045 1:28898301-28898323 GTGGTGAAGATGAGGGGAGAAGG - Intronic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905970189 1:42135979-42136001 TTGTAGAACAGAAAGGAAGAAGG - Intergenic
906079922 1:43079420-43079442 TTGGCAAAGATGAAGTGAGAAGG - Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906504381 1:46367212-46367234 TTGGAGATGAAGAATGCAGATGG - Intergenic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
906842418 1:49153662-49153684 TTAGAGAAGATGAGAAAAGAAGG - Intronic
907089292 1:51709545-51709567 CTGGAGAAGATCAAGGCTGATGG + Intronic
907548058 1:55279374-55279396 TTGGAGATGATGAAAAAAAAAGG - Intergenic
907688184 1:56634847-56634869 ATGGAGAATATCAAGGATGAAGG + Intronic
907814687 1:57906686-57906708 TAAGTGAAGATGAGGGAAGAGGG + Intronic
907942633 1:59104301-59104323 TTGGAGAAAATGAAGGAAAAAGG + Intergenic
908117709 1:60956454-60956476 TTTCAGCAGATGAAAGAAGAGGG + Intronic
908325869 1:63023107-63023129 TAAGAGCAGGTGAAGGAAGAGGG + Intergenic
908516973 1:64902787-64902809 TTGAAGAAGAGGAAGGACAATGG - Intronic
908894219 1:68880765-68880787 TTCGAGGAGCTGAAAGAAGACGG - Intergenic
909735216 1:78950618-78950640 TTGGAGAAGATAAAGAAAAGAGG + Intronic
910491430 1:87776680-87776702 TAGGAGAAGATGCAGGTGGAAGG - Intergenic
910504748 1:87937244-87937266 TTGGAATGAATGAAGGAAGATGG - Intergenic
910774852 1:90864516-90864538 TAGAAGAAGAAGAAGAAAGAAGG - Intergenic
911124016 1:94323449-94323471 TTGGAAAAAGTGAAGGAAGGAGG - Intergenic
911248902 1:95552554-95552576 TTTGAGAAGATGAAAGGGGACGG - Intergenic
911399395 1:97356064-97356086 TTGGAGAAGATGCAGAGAAAAGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
912007813 1:104926208-104926230 ATGGAAGAGATGAAGCAAGAGGG - Intergenic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
912672694 1:111645901-111645923 TGGGAGAAGATGAAGGACTTAGG + Intronic
913690224 1:121272573-121272595 TTGGTGAAGGTGAAGGAATTCGG + Intronic
913692552 1:121293120-121293142 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
914145004 1:144986974-144986996 ATGGAGAAGTTGTAGAAAGAAGG - Intronic
914147316 1:145007386-145007408 TTGGTGAAGGTGAAGGAATTCGG - Intronic
914253526 1:145941612-145941634 TTTGTGGAGAGGAAGGAAGATGG + Intronic
914562579 1:148835419-148835441 TTTGACAAGTTGAGGGAAGAAGG - Intronic
914610251 1:149294803-149294825 TTTGACAAGTTGAGGGAAGAAGG + Intergenic
915339631 1:155169546-155169568 ATGGAGAAGATGAAGCTATATGG + Exonic
915875918 1:159612158-159612180 ATGAAAAAGATGGAGGAAGAGGG - Intergenic
916346546 1:163798050-163798072 TTGAAGAACAGGAAGGAAGAAGG - Intergenic
916503602 1:165408005-165408027 GTGGGGAAGATGAAAGATGACGG - Intronic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
916845807 1:168649077-168649099 TGGGAGAAAATGTAGAAAGAAGG + Intergenic
917544365 1:175947911-175947933 TGAGAGAAAATGAATGAAGAAGG - Intronic
917667536 1:177239833-177239855 TTGGGGAAGATGCAGGAATCTGG + Intronic
917710735 1:177681371-177681393 TTTTAAAAGATGAAGGCAGAGGG + Intergenic
918181044 1:182086297-182086319 TTGGGGAGGCTGCAGGAAGAAGG - Intergenic
918930817 1:190854649-190854671 TTTTAGAAAATAAAGGAAGAGGG - Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919800697 1:201353137-201353159 TTGATGAAGATAAAGGCAGAAGG - Intergenic
919811088 1:201409200-201409222 TTGGAGAAGAAGCATGAAGCAGG + Exonic
919852366 1:201681634-201681656 TAGGTGAAGATGGAGGAAGTAGG - Intronic
920477544 1:206291060-206291082 TTGGTGAAGGTGAAGGAATTCGG + Intronic
920479871 1:206311477-206311499 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
920654637 1:207866678-207866700 TTGGAGTAGATGCAGGGGGAAGG - Intergenic
920722811 1:208403402-208403424 CTGGACAAGATGGAGTAAGAAGG + Intergenic
920900186 1:210102409-210102431 TTTGAGAAGGTGGAGAAAGAAGG - Intronic
921116889 1:212100364-212100386 TAGGAGTATTTGAAGGAAGAGGG - Exonic
921555215 1:216590627-216590649 TTGGAGAAAATGAAGGCAGAAGG + Intronic
921582900 1:216915442-216915464 GTGGAGAGGAAGAAGGGAGAAGG + Intronic
921721623 1:218478515-218478537 GTGGAGAAGATGAAGAAATGTGG - Intergenic
921943578 1:220869801-220869823 TAGGAGAAGATGATGAAATATGG - Intergenic
922852206 1:228742542-228742564 TAGGAGAAAATGAAGGAAGGAGG + Intronic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923765863 1:236891857-236891879 ACAGAGAAGATGAAGGATGATGG + Intronic
924644800 1:245867707-245867729 TGGGAGAAAAACAAGGAAGAGGG + Intronic
924797016 1:247300034-247300056 TTGGACTAGAGGAAAGAAGAAGG - Exonic
1062978488 10:1702392-1702414 GGAGGGAAGATGAAGGAAGAGGG + Intronic
1063286166 10:4691345-4691367 TTTTAGAAGATAAAGAAAGATGG + Intergenic
1063518552 10:6720322-6720344 TTGGAGACTAGGAAGGACGAAGG - Intergenic
1063810677 10:9702416-9702438 TTTCAGAAAATAAAGGAAGAGGG - Intergenic
1063810685 10:9702560-9702582 TTTCAGAAAATAAAGGAAGAGGG - Intergenic
1063980190 10:11446351-11446373 TTGGAGAAGATTCAGGCAGTAGG - Intergenic
1065204172 10:23342474-23342496 TGGGTGAAGAGGAAGGAATATGG + Intronic
1065567700 10:27031524-27031546 TTGGAGAAGGTGGAGGGACATGG + Intronic
1065620323 10:27574534-27574556 TTGGATCAAGTGAAGGAAGATGG + Intergenic
1065734452 10:28738872-28738894 TTTGGGAAGATGAAGGAGGCTGG + Intergenic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066205951 10:33189398-33189420 ATGTAAAAGATGACGGAAGAGGG - Intronic
1066813495 10:39372099-39372121 TTTGACAAGTTGAAAGAAGAAGG - Intergenic
1067061531 10:43080392-43080414 TTGGAAAAGATGAAGTGAGTAGG - Intronic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1067544113 10:47179579-47179601 GTGGTGAAGATTAAGAAAGAAGG + Intergenic
1068027498 10:51665725-51665747 TTTTAAAAAATGAAGGAAGAAGG - Intronic
1068394226 10:56440836-56440858 TTGGACAAGAAGAAGCAATATGG - Intergenic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069536003 10:69253573-69253595 TTGGTGAAAATGGAGGAACATGG + Intronic
1069636257 10:69926707-69926729 TGGGAGAAGAGGAAAGAACAAGG + Intronic
1069647018 10:70007782-70007804 TTGGAGAACATGCAGGGAGGAGG + Intergenic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070091626 10:73291565-73291587 TTGAAGAAGAGAAAGGAAAAAGG + Intronic
1070574431 10:77666846-77666868 TTGGAGAGCATCAATGAAGATGG - Intergenic
1070769299 10:79072998-79073020 TTAGAGAGGATGAAGGGAGAAGG + Intronic
1071250937 10:83818944-83818966 TTGGAGGAGAGAAGGGAAGAAGG - Intergenic
1071390996 10:85175264-85175286 TAGGAGAAGGGGATGGAAGAGGG - Intergenic
1071900029 10:90110468-90110490 TTGGAGAGGATGTAGAAAAAAGG - Intergenic
1072039878 10:91596841-91596863 TTGGGGAGGAGGATGGAAGAGGG + Intergenic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072333714 10:94378553-94378575 TTGGTGAGGATTCAGGAAGATGG + Intergenic
1072837951 10:98736974-98736996 ATTGAGAAGATGAAGGTTGAAGG + Intronic
1073736055 10:106348077-106348099 TCTGAGAAGATGAAAGATGATGG + Intergenic
1074111999 10:110429332-110429354 GTGGTGAAGATGAAAGAAAAAGG - Intergenic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074388556 10:113037130-113037152 TTGTAGAAGATGAAGGAAGCTGG + Intronic
1074410665 10:113225739-113225761 GTGGAGTGGAGGAAGGAAGAGGG + Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075313520 10:121433853-121433875 GTGGAGAGCATGGAGGAAGATGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075864573 10:125706615-125706637 TTGAAGAAGATGACAGGAGATGG + Intergenic
1076034512 10:127187934-127187956 GTGAAAAAGATAAAGGAAGAAGG - Intronic
1076108064 10:127840268-127840290 TTGCTGAAGATGGAAGAAGAAGG + Intergenic
1076160161 10:128237535-128237557 TTACAGATGCTGAAGGAAGATGG + Intergenic
1076348002 10:129793854-129793876 AAGGAAAAGAGGAAGGAAGAGGG - Intergenic
1077164034 11:1127085-1127107 TCGGACAACATGAAGGCAGACGG + Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077736196 11:4794214-4794236 TAGGAGAACATGAAGCAAAAGGG + Intronic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078001829 11:7502958-7502980 TTGGAGAATAGAAAGAAAGAAGG + Intronic
1078512903 11:11998702-11998724 TGGGAGACGAAGAAGGCAGAAGG - Exonic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078887705 11:15521410-15521432 TTGGAGAGGATGTAAGAAGAGGG - Intergenic
1079508996 11:21188123-21188145 TTGGGGAAGATGAAGGGGAAAGG + Intronic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1079930591 11:26554952-26554974 CTGGAAAAGATGGAGTAAGAGGG - Intronic
1079936076 11:26618088-26618110 TTGGAGAAAATGATGGTACAGGG - Intronic
1080065878 11:28012456-28012478 TTTGAGAAAATGGAGCAAGAGGG + Intergenic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG + Exonic
1080886906 11:36376293-36376315 TGGGAGGAGAAGGAGGAAGAGGG + Intronic
1080960805 11:37157640-37157662 AAGGACAAGATGAGGGAAGAAGG - Intergenic
1080974229 11:37316928-37316950 TTGGAGAGGATGAAGGATGGAGG - Intergenic
1081013311 11:37843568-37843590 CGAGAGAAGATGAAGCAAGAGGG - Intergenic
1081232608 11:40604769-40604791 ATGGATAAAATAAAGGAAGAAGG + Intronic
1081258725 11:40931192-40931214 TTGCAGAAAATGAAGACAGAGGG + Intronic
1081384007 11:42449153-42449175 TTACAGAAGATGAAGAAAAAAGG - Intergenic
1081403102 11:42665529-42665551 TTGGAGAACACGAGGGAAGCAGG - Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1082182246 11:49133707-49133729 TAGGAAAACAAGAAGGAAGATGG - Intergenic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082939156 11:58685646-58685668 TTGGACAAGATGAAGGCCAAAGG + Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083225672 11:61282969-61282991 ATGGAGATGAGGGAGGAAGAGGG - Intronic
1084360402 11:68665222-68665244 CGGGAGGAGATGAGGGAAGAGGG + Intergenic
1085484362 11:76849369-76849391 TTGGGTAAGACAAAGGAAGAAGG - Intergenic
1086311389 11:85539818-85539840 TTGAAGCTGATGAAGGAAAATGG + Intronic
1086400280 11:86455955-86455977 TTGGAGAAAATTAAGGACAAAGG - Intronic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1086683262 11:89701239-89701261 TAGGAAAACAAGAAGGAAGATGG + Intergenic
1086867831 11:92001685-92001707 GTGGAGAAAATGAAGGAAGGAGG + Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1087004139 11:93452453-93452475 GTGGAGGAGATGAAGGAAGTGGG + Intergenic
1087546482 11:99590756-99590778 TTTGAGATGATTAAAGAAGAAGG + Intronic
1087573402 11:99960324-99960346 TTAGGAAAGATGAAGGAAAAAGG - Intronic
1087711073 11:101553140-101553162 TTGAATCAGATGAAGAAAGAGGG - Intronic
1087838256 11:102896421-102896443 CTGGAGAGGATGTGGGAAGAGGG - Intergenic
1088259687 11:107932411-107932433 TGGCAGAAAATTAAGGAAGAAGG - Intronic
1088277358 11:108101884-108101906 TCAGAGAGGAAGAAGGAAGAAGG - Intronic
1088485167 11:110333606-110333628 TTTGAAAAGATGAAGAAAGAAGG + Intergenic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1088965578 11:114717748-114717770 GTCGAGAAGATGAGGGAGGAGGG - Intergenic
1089025273 11:115262882-115262904 TAGGAGAAGGTGGATGAAGAAGG - Intronic
1089087374 11:115833812-115833834 TTTGAAAAAATGAATGAAGAGGG + Intergenic
1089097024 11:115927690-115927712 TTCGAGAAGCTGAAAGAAGATGG + Intergenic
1089099363 11:115948664-115948686 TTGATGAAGATAAAGAAAGATGG + Intergenic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089384254 11:118057639-118057661 TGGGAGAAGAACAAGGATGAAGG + Intergenic
1089674450 11:120080575-120080597 TGGGGGAAGATCAAGGCAGAAGG - Intergenic
1090188352 11:124752367-124752389 GGGGAGAAGAGGAAGGAAGGAGG - Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091084638 11:132709506-132709528 TTGGAGGAGATTTAGGAAAAAGG - Intronic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091438530 12:494500-494522 TGGTAGAAAATGGAGGAAGAGGG - Intronic
1091856713 12:3746417-3746439 TGGGAGAGGAAGAAGGGAGAGGG - Intronic
1091884280 12:4004528-4004550 TTTGAGGAGAGAAAGGAAGAGGG - Intergenic
1092014015 12:5141666-5141688 TTGGTGAAGATGGATAAAGATGG - Intergenic
1092087017 12:5770917-5770939 TTGGAGCAGATGGAGGAGGTAGG - Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092711510 12:11342416-11342438 TTAGAGGATATGAAGGAAGAAGG - Intergenic
1092955843 12:13548953-13548975 TAGGAGAGGAGGTAGGAAGATGG - Exonic
1093531957 12:20176079-20176101 TTGGGGAGGAAGAAGGATGAAGG - Intergenic
1093849458 12:24018105-24018127 TAGGGGCAGATAAAGGAAGATGG - Intergenic
1094084390 12:26573780-26573802 TTGGAGGAGATGGAGGGTGATGG + Intronic
1094412065 12:30177044-30177066 TGGAAGAAGATGTAGGAAAAGGG - Intergenic
1094432211 12:30381759-30381781 TTGAAGAAGAAGAACAAAGATGG + Intergenic
1094522629 12:31208946-31208968 CTGTAGAGGATGAAGGAAGCAGG - Intergenic
1094769843 12:33642626-33642648 TTGGATAAGCTGAGTGAAGATGG + Intergenic
1095598994 12:43993548-43993570 TTGGAGAAGATGGAGGGGGGTGG + Intronic
1095790934 12:46166228-46166250 TTGGAGAGTATTATGGAAGAGGG + Intergenic
1096176547 12:49524495-49524517 TTGGAGGAAGTGGAGGAAGAGGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096784914 12:54011307-54011329 GAGGAGAAGGTGGAGGAAGAAGG + Exonic
1096963023 12:55599220-55599242 TTTGACAAGTTGAAAGAAGAAGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1098237898 12:68435622-68435644 TGTGAGAAGAAGAAGTAAGAGGG + Intergenic
1098492150 12:71093945-71093967 TGGGAGGAGATGGAGCAAGATGG - Intronic
1098633597 12:72754371-72754393 TTGTGGAAAATGAAGGTAGAGGG - Intergenic
1098730053 12:74024670-74024692 ATGGAGGAGATGGAGGAAGAGGG + Intergenic
1098957945 12:76706848-76706870 TTTGGGGAGAGGAAGGAAGAAGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099514623 12:83582438-83582460 TTAGAGAAGATCATCGAAGAAGG + Intergenic
1099619668 12:84985629-84985651 TTGGTGATGTTGAAGGAAAATGG - Intergenic
1099627989 12:85100719-85100741 ATTGAGAGGATGAAGGGAGAAGG + Intronic
1100052444 12:90465102-90465124 TTGGTGAAGATGCAGAAAAAAGG - Intergenic
1100169942 12:91963057-91963079 AAGAAGAGGATGAAGGAAGAAGG - Intergenic
1100737893 12:97558078-97558100 GAGGAGGTGATGAAGGAAGAGGG - Intergenic
1101117493 12:101546511-101546533 TTGGAGAGGATGGGGGAAGGGGG + Intergenic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101372562 12:104142681-104142703 TAGGAGGAGATGAGGGTAGAGGG - Intergenic
1101410998 12:104468231-104468253 TTGAAGGAGATGAGGGTAGATGG + Intronic
1101533975 12:105600545-105600567 TTGGAGATTATGAATGGAGATGG + Intergenic
1101821547 12:108188139-108188161 TTGGGGAAGATAAATGAAAATGG + Intronic
1101965596 12:109279900-109279922 TGGGAGGAGATGAAGGATGAGGG - Exonic
1102815354 12:115860827-115860849 TGGGAGAAGAAACAGGAAGATGG - Intergenic
1102843489 12:116152018-116152040 TAGGAGATTATGAAGGGAGAGGG - Intronic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1102937798 12:116911967-116911989 TTGGAGAATCTGGAGGAAGCTGG + Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103110339 12:118271886-118271908 TTGCAGGAGGTTAAGGAAGAGGG - Intronic
1104057755 12:125243712-125243734 TTGGGGACTATGACGGAAGAGGG - Intronic
1104107381 12:125675858-125675880 TTTGAGAAGGTGCAGGAGGATGG + Intergenic
1104529420 12:129554806-129554828 TTTGAGAAGTTGTAGGAAGCTGG - Intronic
1104659244 12:130597927-130597949 TTGGAAAAGAAGGAGGAAAATGG + Intronic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1105044454 12:132990572-132990594 TTTCAGAAGATAAAGGCAGAGGG - Intronic
1105273835 13:18903497-18903519 TTGGGGTAGATGAAGAAAAAGGG - Intergenic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1105637336 13:22228106-22228128 TTGTGGAAGATACAGGAAGAAGG + Intergenic
1105803922 13:23938672-23938694 TTGGGGTAGATGAAGAAAAAGGG - Intergenic
1105894172 13:24704336-24704358 ATTGAGAAGATGCAGGAATAAGG - Intronic
1106486369 13:30176401-30176423 TTGGAGAGCATCAAGGAAGATGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107098253 13:36559985-36560007 TTGGAGAAGGGGAGGTAAGAGGG + Intergenic
1107898286 13:44987904-44987926 TTGTAGAAGATGGGGGAGGAGGG - Intronic
1108588707 13:51893438-51893460 CTGGTGAAGCTAAAGGAAGAGGG - Intergenic
1108974537 13:56421880-56421902 TTCGTGATGATGAAAGAAGATGG + Intergenic
1109065385 13:57682152-57682174 TAGGAGTATAAGAAGGAAGATGG - Intronic
1109489766 13:63082014-63082036 TTGGACATGATGAATGAAGATGG + Intergenic
1109596564 13:64563450-64563472 TTGAAGGAGATGAATGAAGTTGG - Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1110091889 13:71461244-71461266 TAAAAGAAGATGTAGGAAGATGG + Intronic
1110463597 13:75775817-75775839 TTGGTGAAGATGCAGATAGAAGG + Intronic
1111186152 13:84738435-84738457 CTGGATATGATGGAGGAAGATGG + Intergenic
1111453517 13:88449849-88449871 CTGGAGGAGATGAATGAAGGAGG - Intergenic
1111621096 13:90726966-90726988 GTGGAGAAGATGGAGGAAAATGG + Intergenic
1111653594 13:91124981-91125003 TTGAAGAACATGGAGAAAGAAGG + Intergenic
1111877902 13:93919461-93919483 TTGAAGGAGATGTAGGAACATGG - Intronic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112352974 13:98651943-98651965 TTGGAGCAGCTGGAAGAAGAAGG - Intergenic
1112560297 13:100506772-100506794 TAGGAGGAGAAAAAGGAAGAGGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112740202 13:102464409-102464431 TTGGTGAGGCTGGAGGAAGAAGG + Intergenic
1112827522 13:103408682-103408704 ATGGGGAAGATGCAGGAAAAAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113794064 13:113046574-113046596 TTGTAAAAGATGAAGGAATGAGG - Intronic
1114042384 14:18691141-18691163 TAGGAGAAGCTGTAGGAAGACGG - Intergenic
1114120480 14:19666188-19666210 AGGAAGAAGATGAAAGAAGAAGG + Intergenic
1114373152 14:22112392-22112414 TAGGAGAAGTTGGATGAAGAGGG + Intergenic
1114996751 14:28363632-28363654 TTTGCCAAGATGAAGAAAGAGGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115224878 14:31092202-31092224 GAGGAGAAAATGAATGAAGAAGG - Intronic
1115298130 14:31853447-31853469 ATGGAGAAGGTGGAGTAAGAAGG - Intronic
1115494600 14:33990609-33990631 TTGGAGAAGATGGAAGAAAATGG - Intronic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1115861058 14:37686960-37686982 CTGGAGAAGGTGGAGCAAGATGG + Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116717941 14:48451333-48451355 GAGGAGAAGAAGAAGAAAGAAGG - Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1117472504 14:56060343-56060365 GTGGGGAAGATGCATGAAGAAGG - Intergenic
1117677061 14:58165964-58165986 TTGGAGAGGATACAGGAAGGTGG - Intronic
1117940969 14:60964285-60964307 TTGGAGAAGAGGGAGGGAAAAGG - Intronic
1118640330 14:67786235-67786257 TGGAAATAGATGAAGGAAGAGGG + Intronic
1118805297 14:69231246-69231268 TCTGAGGAGAAGAAGGAAGAAGG - Intronic
1118946086 14:70388660-70388682 TTAGAGAAGATGAAGAGAAAGGG + Intronic
1119155468 14:72406018-72406040 TGGGAGAGGGTGAAGGAAGGAGG + Intronic
1119258651 14:73222693-73222715 TTAGAGAAGTTAAAGAAAGATGG - Exonic
1119531884 14:75367544-75367566 TTGGGGAAATTGAATGAAGAAGG + Intergenic
1119909799 14:78339151-78339173 TTGGAGAAGCTGAAGGAAAGAGG + Intronic
1120845310 14:89119962-89119984 TGGTAGAAGATGCAGCAAGATGG + Intergenic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121348293 14:93152580-93152602 GTGGAGAAGATGATGGAATCAGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121924822 14:97917975-97917997 TTGCTGAGGATGAAGCAAGATGG - Intergenic
1122527309 14:102396542-102396564 TTGGGGAAAATGGTGGAAGAGGG + Intronic
1122667207 14:103339166-103339188 TTGCAGAAAAAGAAAGAAGAGGG + Exonic
1123127940 14:105962789-105962811 TTGGAGAACTTGAAAGGAGAAGG + Intergenic
1123408457 15:20038932-20038954 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123504609 15:20928062-20928084 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1123517781 15:21045573-21045595 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123561858 15:21501763-21501785 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1123598100 15:21939044-21939066 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1124049340 15:26180432-26180454 ATGGAGTTGATAAAGGAAGAAGG + Intergenic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1124851051 15:33339340-33339362 TTGGAGAGGATGAAAGACTAAGG + Intronic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125840142 15:42792877-42792899 TTGGAGAAAATATTGGAAGATGG + Intronic
1125878365 15:43169273-43169295 TTGGAGGAGGTAAAGCAAGATGG - Intronic
1126265054 15:46744470-46744492 TTTGAGGAGCTGAGGGAAGAAGG - Intergenic
1126405679 15:48320310-48320332 TTGGCGAGGAAGACGGAAGAAGG + Intergenic
1126465251 15:48955802-48955824 TGGGGGAAGATGAAGCAAGGTGG + Intronic
1126567419 15:50114552-50114574 AGTGAGAAGAGGAAGGAAGATGG - Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127173342 15:56327428-56327450 TTGGAGGGGGTGAAGCAAGATGG + Intronic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127364832 15:58279047-58279069 GTGGAGAAGAGGTAGTAAGAAGG + Intronic
1127462741 15:59214196-59214218 TAGAATAGGATGAAGGAAGAGGG + Intronic
1127686985 15:61355797-61355819 TCAGACAAGATGAATGAAGAAGG - Intergenic
1127697394 15:61463816-61463838 TTGGAGAGGACTAAGGGAGAAGG - Intergenic
1127864107 15:63017729-63017751 TGGCAGAAGAACAAGGAAGATGG - Intergenic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128149930 15:65356293-65356315 TGGGAAAAGAAGAGGGAAGATGG + Intronic
1128378810 15:67096192-67096214 TTGAAAATGATGACGGAAGAAGG + Intronic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128754568 15:70172611-70172633 ATGGAAAAAATGGAGGAAGAAGG + Intergenic
1128951525 15:71888866-71888888 TTGGCAAAGATGAAGTAATAGGG + Intronic
1129026574 15:72580568-72580590 TTGGCAAAGATAAAGAAAGAAGG - Intronic
1129057835 15:72834516-72834538 TGGCAGAGGATGAAGGAGGAGGG + Intergenic
1129089886 15:73137960-73137982 TTAGAGGAGAGAAAGGAAGAGGG + Intronic
1129603897 15:77015512-77015534 TTGGACAGGATGAGGGGAGATGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129878273 15:78991192-78991214 TAGCATCAGATGAAGGAAGAGGG + Intronic
1129944280 15:79525494-79525516 AGGAAGGAGATGAAGGAAGAAGG + Intergenic
1130175914 15:81570627-81570649 TTGGAGAAGGTGGGGAAAGAAGG - Intergenic
1130364576 15:83222669-83222691 TTTGAGAAGTTGAGAGAAGAAGG + Intergenic
1130847689 15:87762511-87762533 TTGGTGAAGATGAAAGGAGATGG + Intergenic
1131094732 15:89648188-89648210 GTGGTGGAGAGGAAGGAAGAGGG - Intronic
1131476358 15:92743551-92743573 TTGGAGAGTCTGAAGGAAGGAGG + Intronic
1202970201 15_KI270727v1_random:228889-228911 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1133551199 16:6856000-6856022 TTAGAGAATATAAGGGAAGATGG - Intronic
1133598315 16:7314104-7314126 TTGGGGAGGAGGAAGGGAGAGGG + Intronic
1133626563 16:7575443-7575465 TTTAAGAAGAAAAAGGAAGAGGG + Intronic
1133870225 16:9678937-9678959 TTTGAGAAAAGGAAGGAAAAGGG - Intergenic
1134363740 16:13557168-13557190 TTAGGGGAGAGGAAGGAAGAGGG - Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1135335348 16:21597119-21597141 TTCTAGTAGATGAAGGAAGGGGG + Intergenic
1135346808 16:21695737-21695759 TTGGGGAAAATGAAGGAAGTGGG - Intronic
1135609227 16:23850757-23850779 TTGGAGAAGATGTAGAGAAAAGG - Intronic
1135660708 16:24294199-24294221 TTAGAGAGGATGCTGGAAGAAGG + Intronic
1135997629 16:27264025-27264047 TGGGAGAAAATAAAGGCAGAAGG + Intronic
1137007242 16:35288333-35288355 TTTGACAAGATGAGAGAAGAAGG + Intergenic
1137219762 16:46437120-46437142 GAAGAGAAGATAAAGGAAGATGG - Intergenic
1137374556 16:47941598-47941620 TTGCAGAAGAGGAAGGAGTAGGG + Intergenic
1137380001 16:47988977-47988999 TTGGAGAAGATGTAGAGAAAAGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137603098 16:49769774-49769796 TTGGAGATGAGGGAGGGAGACGG - Intronic
1137853753 16:51773000-51773022 TTGGAAAAGAGGAAGAAAAAGGG + Intergenic
1137968052 16:52956310-52956332 TAGCAGAAGATGAAGACAGAAGG + Intergenic
1138583600 16:57956965-57956987 TTGGCCAAGCTGAAGGGAGAGGG - Intronic
1138761063 16:59544925-59544947 TTGGAGAAGGTGAAATTAGAAGG + Intergenic
1139327840 16:66165769-66165791 TTGGAGAGGAGGAAAAAAGAAGG + Intergenic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1141067715 16:80927411-80927433 TTGGAGGAGGTGAATGAAGGAGG + Intergenic
1141283642 16:82651353-82651375 TGGGTGAAGATCAATGAAGATGG - Intronic
1141373331 16:83507169-83507191 TGTGAGAAAATGAAGAAAGAGGG - Intronic
1141514560 16:84535092-84535114 TTGGGGGAGAAGGAGGAAGAAGG - Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1142574187 17:895326-895348 TTAGAGAAGATGAACTATGAAGG - Intronic
1142588788 17:991576-991598 TTGGAGAAGAGCAAGGTAGGAGG + Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143105142 17:4525980-4526002 TAGAGAAAGATGAAGGAAGAAGG + Intronic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143179378 17:4974601-4974623 TTGGGGAAGATAAAAGAATATGG - Intronic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143864702 17:9915742-9915764 ATGGGAAAGATGAAGAAAGATGG + Exonic
1143907040 17:10217125-10217147 GTGGAGAAGAGGCAGGAACAGGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144523420 17:15969488-15969510 GTAGAGAAGATGCAGGAAAAAGG - Intronic
1144582889 17:16469847-16469869 TGGGAGAGGATGAAGGGAGAGGG + Intronic
1144688004 17:17238829-17238851 TTGGTAAAGATTAAGGAATATGG + Intergenic
1144707456 17:17378983-17379005 TTAGGGAAGATGAAAGGAGAGGG - Intergenic
1144771533 17:17762272-17762294 TTGGAGAAGACCCAGGAGGATGG + Intronic
1144930218 17:18852917-18852939 TTGGTGAAGATGAAGAGACATGG + Intronic
1145123105 17:20278302-20278324 TTGGAGAATTAGAAGCAAGAGGG + Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146322874 17:31859937-31859959 TTGAGGGGGATGAAGGAAGAGGG - Intergenic
1146510289 17:33441603-33441625 TGGGAGAAGGAGAAGGAAGGAGG - Intronic
1147285220 17:39397220-39397242 TTGGATAAAATGAAGCAAGTAGG + Intronic
1147316220 17:39621671-39621693 TTGGAGAGGTTGGGGGAAGAAGG + Intergenic
1147439838 17:40441286-40441308 TGGGGGAAGAAGCAGGAAGAGGG + Intergenic
1147663194 17:42128603-42128625 TTTGAGAAGATGAAGGGCAAAGG + Intronic
1147982608 17:44283756-44283778 TTTGAGAAGATGGGGGAAGTTGG + Intergenic
1148088354 17:45007882-45007904 TGGGAGATGGTGGAGGAAGATGG - Intergenic
1148116824 17:45180614-45180636 GTTGAGAAGATGAAGAGAGATGG - Intergenic
1148116928 17:45181390-45181412 GTTGAGAAGATGAAGAGAGATGG - Intergenic
1148330659 17:46812117-46812139 TGGGAAAAGAGGAAGGAAGCTGG - Intronic
1148546430 17:48522566-48522588 CTGGAGAGGATGAAGGAAAGGGG + Intergenic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1149206257 17:54252187-54252209 TTAAGGAAGAGGAAGGAAGAAGG + Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150332906 17:64308777-64308799 CTGGAGTAGAGGGAGGAAGAGGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151057918 17:71055435-71055457 TTAGAGAAGAGAAAGGAAGAAGG - Intergenic
1151383734 17:73742787-73742809 TGGGAGAAGAGCAAGGAACACGG + Intergenic
1151637675 17:75362913-75362935 TGGGGGTAGAGGAAGGAAGAGGG + Intronic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1152197850 17:78928062-78928084 TTGGAGGAGATAATGGTAGAGGG - Intergenic
1152412793 17:80137690-80137712 ATGGAGAAAATGAAGTAAGAGGG - Intronic
1152499767 17:80700063-80700085 ATGGAGAAAAGGTAGGAAGAAGG + Intronic
1152660137 17:81538242-81538264 TTGGAGCAGGTGGAGGAAGCTGG + Intergenic
1152984707 18:311213-311235 ATGGAGAATATGGAGGAAGGGGG + Intergenic
1153292922 18:3519469-3519491 TTGTTGAAGATGAGGGAATAGGG - Intronic
1153709722 18:7785165-7785187 GTGAAGGATATGAAGGAAGAGGG + Intronic
1153902031 18:9625797-9625819 TTGCTGAAGATGAAGAAAGGAGG - Intergenic
1154110875 18:11567484-11567506 CTGGAGGAGGTGGAGGAAGAGGG + Intergenic
1154162470 18:11990434-11990456 ATAGAGAAGATGAAAGCAGAAGG + Intronic
1154465542 18:14640737-14640759 TTGGGGTAGATGAAGAAAAAGGG - Intergenic
1154962507 18:21324008-21324030 TTGGAGATTCTGAAGGGAGAAGG + Intronic
1154965988 18:21356807-21356829 TTGGAGAGGATGTAGAAAAAAGG - Intronic
1155416117 18:25601559-25601581 TTGGAGGTGCTGAAGGAAGCAGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156384792 18:36595283-36595305 ATGGAGGAGAGGAAGGGAGAAGG - Intronic
1156854284 18:41764411-41764433 TTGGTGAAGATGAAGTCACAGGG + Intergenic
1157201659 18:45664676-45664698 TTGGGGGAGCTGGAGGAAGAAGG - Intronic
1157715525 18:49883677-49883699 TTGAAGAAGATGAACAAAGCTGG + Intronic
1157967574 18:52225423-52225445 ATGGAGGAGAGGAAGGAAAAAGG - Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158209056 18:55025798-55025820 GTGAAGAAGATGAAGGAGAAGGG - Intergenic
1158224130 18:55182864-55182886 TTGGAGAAGATGAGGAAAATAGG - Intergenic
1158382519 18:56948989-56949011 GTGGAGAAGATGCAGAGAGAAGG - Intronic
1158420313 18:57287351-57287373 TTGGAGAAGATGGAGTAGGAGGG - Intergenic
1158500124 18:57993507-57993529 TTGGAGCAGCTGAGGGAAGCAGG + Intergenic
1158731068 18:60022962-60022984 TTTAAGAAGAAGAAGCAAGAAGG + Intergenic
1159725124 18:71947964-71947986 AAGGAAAAGAGGAAGGAAGAGGG + Intergenic
1159746314 18:72240237-72240259 TTGAAGAAGATGAATGAAGTTGG - Intergenic
1160267327 18:77350782-77350804 TTCCACAAGATGAAGAAAGAGGG - Intergenic
1160429719 18:78803208-78803230 TTGGAGGAGAAGAAGCCAGATGG - Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1161348867 19:3781567-3781589 TTGGGGGTGCTGAAGGAAGATGG - Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161601901 19:5189212-5189234 GTGCAGAAGATGAACGTAGATGG - Intronic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163060673 19:14759163-14759185 TTGACAAAGATAAAGGAAGAGGG + Intronic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163227824 19:15977432-15977454 TTGGCAAAGATAAGGGAAGAGGG + Intergenic
1163850223 19:19658678-19658700 TTGGTGAAGATGAAGGGAGAGGG + Intronic
1164441199 19:28282077-28282099 TCGGGGAAGAAGAAGAAAGAAGG - Intergenic
1164594300 19:29523849-29523871 GATGAGAAGATGAAGGAAAAGGG + Intergenic
1165328739 19:35129191-35129213 TTGGATAACTTGAATGAAGAGGG + Intronic
1165375961 19:35442174-35442196 TTAGAAAAGAAGAAGGAAGTTGG + Intergenic
1165958859 19:39518377-39518399 TGGGAGAAGATGGAGACAGAGGG + Intronic
1166018088 19:39998489-39998511 TTGGAGAAGATTGGAGAAGATGG - Intronic
1166158828 19:40936342-40936364 TTGCAGAAGAAGTTGGAAGAAGG - Intergenic
1166167765 19:41004247-41004269 TTGTAGAAGAAGTTGGAAGAAGG - Intronic
1166170784 19:41026391-41026413 TGGGAGAAGATGATGGAAGGGGG + Intergenic
1166860038 19:45804763-45804785 GTGGAGGAGATGACGGAAGGTGG - Exonic
1166886780 19:45966283-45966305 TTGGAGGAAGGGAAGGAAGAAGG - Intronic
1167883420 19:52481261-52481283 TAGGAGGACATGAAGGAAGAAGG - Intronic
1168602429 19:57728437-57728459 TTGGAGTGGAAGAAGGAAGAGGG + Intronic
925097624 2:1219894-1219916 TTTCAGAAGAAGAAGGCAGATGG + Intronic
926465470 2:13181345-13181367 TAGGAGAGGATGATGGGAGAAGG + Intergenic
926527682 2:14002468-14002490 TTGGAGAGGATGTGGGGAGAAGG + Intergenic
926601887 2:14854347-14854369 TTGGAGAGGGTGGAGCAAGATGG + Intergenic
926946219 2:18190236-18190258 TTGGAGCAGAATAAAGAAGATGG + Intronic
927002419 2:18811943-18811965 TTGGAGAAGTGGAGGGGAGAGGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
928485280 2:31724719-31724741 TTGGAAAAGATGTTGGAGGAAGG + Intergenic
929446501 2:42005701-42005723 CTGGAAGAGATGATGGAAGAAGG + Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930258937 2:49122946-49122968 TTGGAGAAGAGGATGATAGAGGG - Intronic
930511389 2:52349727-52349749 GTGGAGGAGAGGAAGGAAGAAGG - Intergenic
931287639 2:60846124-60846146 TTTGAGAAAATGATGGTAGATGG - Intergenic
931736368 2:65198466-65198488 TAGGAGGAGATAAAGCAAGATGG + Intergenic
932078023 2:68684342-68684364 TTGGAAAAGAAGAAGTAAAAAGG + Intronic
932132154 2:69197419-69197441 TTGGAGGTGATGAAGGAATCTGG - Intronic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932182221 2:69657494-69657516 TTGGAGAATAAGTAGGATGATGG - Intronic
932541889 2:72664066-72664088 TGGGAGACGAGGCAGGAAGATGG + Intronic
932601042 2:73125827-73125849 TTCCAGAAAATGAATGAAGAAGG + Intronic
933401834 2:81808403-81808425 TTGGAGATTATAAAGAAAGATGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933656712 2:84894531-84894553 TTGAAGCAGAAGAAGGAAGTGGG - Intronic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934156054 2:89202167-89202189 TTGGAGAAGATGAAAGTCTAGGG + Intergenic
934211261 2:89980595-89980617 TTGGAGAAGATGAAAGTCTAGGG - Intergenic
934636608 2:95995055-95995077 TGGAAGAAAATGAAGAAAGATGG - Intergenic
934716379 2:96547018-96547040 TTGGAGCAGAGGAAAGAAAAGGG + Intronic
934836371 2:97593055-97593077 TGGAAGAAAATGAAGAAAGATGG - Intergenic
934974870 2:98794383-98794405 TTGGGGAAGAGGAAGGAACCAGG - Exonic
935544759 2:104389124-104389146 ATGGAGAAGATGAAGAGAAAAGG + Intergenic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
935901568 2:107798763-107798785 ATGGGGAGGATGAAGGAAGCTGG + Intergenic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936501668 2:113071776-113071798 TGAGAGAAGAGAAAGGAAGAAGG - Intronic
936588800 2:113783357-113783379 TGGGAGAAGAGGTAGGTAGAGGG - Intergenic
936780482 2:116027084-116027106 TGGGAAAAAAGGAAGGAAGAAGG - Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937499373 2:122461834-122461856 ATGGAGAAAATTAAGGCAGACGG + Intergenic
938267780 2:129941071-129941093 TAGGATAAGCTGTAGGAAGATGG + Intergenic
938782058 2:134593524-134593546 TTGGAGGAGATGGCCGAAGAAGG + Intronic
939052029 2:137318742-137318764 TTGGAAAAGCTGAAGGACAAAGG - Intronic
939379696 2:141418675-141418697 TTGGGGAAGATGGACAAAGATGG - Intronic
939776598 2:146395320-146395342 GTGGTGGAGATGAAGGAAGCTGG - Intergenic
940517523 2:154699166-154699188 ATGAAGAAGAGGAAGGCAGAAGG - Exonic
940962652 2:159802162-159802184 TTGGAGAAGATAAAATGAGAGGG - Intronic
941428661 2:165384289-165384311 TTGGAGCAAATGAAGGACAAAGG + Intronic
941546252 2:166854852-166854874 TTTGATGAGATGAGGGAAGAAGG + Intergenic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
941839809 2:170069086-170069108 TTTCAGAAAATAAAGGAAGAAGG + Intronic
942440214 2:176026737-176026759 TTGGAGTACATGAAGAGAGAAGG + Intergenic
942481714 2:176395165-176395187 TTGGAGTAGTTGAAGGATAAGGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942898421 2:181086154-181086176 TTGGATAAGAAGTATGAAGAAGG + Intergenic
942914437 2:181286107-181286129 TTGGAGAAGATTTTGGAAAATGG + Intergenic
943084237 2:183293646-183293668 TGGTAGAAGAGGAAGAAAGAGGG + Intergenic
943151713 2:184122197-184122219 TTGGAGATGTTTAAGGATGATGG - Intergenic
943158358 2:184214193-184214215 TTCCAAAAGATGAAGAAAGAAGG - Intergenic
943187618 2:184632768-184632790 TTGGGGTAGAAGAAGGAAAAGGG + Intronic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943696531 2:190941717-190941739 TTTGAGAAGGGGAAAGAAGAAGG + Intronic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944504993 2:200402024-200402046 ATGGGGAAGATGAAGGCACATGG - Intronic
944794013 2:203163573-203163595 TTTGGGAGGATGAAGGAGGAAGG - Intronic
944884079 2:204044706-204044728 ATGGAGAGGATGAGGGAAAAAGG + Intergenic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945450014 2:209983299-209983321 TTGGAGAATATCAAAGAATAGGG + Intronic
945460007 2:210095321-210095343 TTGGAGAAGAAGTAGAGAGAGGG - Intronic
946022868 2:216653637-216653659 CTGGAGATGAGGAAGGCAGATGG - Intronic
946321045 2:218954748-218954770 TGGGGGCAGATGAAAGAAGAGGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946573664 2:221051244-221051266 TTGGAGGAGAGGGAAGAAGAAGG + Intergenic
947128733 2:226898889-226898911 TTGGACAAGGTAAAGGAACAAGG - Intronic
947246252 2:228051831-228051853 TAGGTGAGGATGAAGCAAGAAGG - Intronic
947348395 2:229217838-229217860 GAGGAGAAGATTAAGCAAGAAGG - Intronic
947450646 2:230205312-230205334 TTGGTGATGATGAAGAAAGAAGG - Intronic
947942562 2:234071086-234071108 TCCAAGAAGATGAAGGATGAAGG - Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948318762 2:237052309-237052331 TTTGACAGGCTGAAGGAAGAAGG + Intergenic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948644447 2:239395061-239395083 CTGGAGAAGAGGAAGGTAAAGGG + Intronic
948906533 2:240982285-240982307 TTGGACAAGCTGAAGGCAGAGGG + Intronic
948964146 2:241363254-241363276 GTGGAGGAGAGGAAGCAAGAGGG - Intronic
1169004039 20:2192216-2192238 GTGGAGAGGAGGAAGGATGACGG - Intergenic
1169010671 20:2247498-2247520 TTTGAGAAAAGGAAGGATGAAGG - Intergenic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169456458 20:5756774-5756796 TTTGGGAAGCTGATGGAAGACGG - Intronic
1169869107 20:10232415-10232437 TTGGAGAAAATAAGGAAAGATGG - Intronic
1170527127 20:17250056-17250078 TTGGGGAAGCTGAATAAAGAAGG - Intronic
1171450013 20:25228986-25229008 TTGGATAAAATCAAGGATGATGG + Intergenic
1171773758 20:29347294-29347316 TTGATGAAGATGAGTGAAGATGG - Intergenic
1171815770 20:29784843-29784865 TTGATGAAGATGAGTGAAGACGG - Intergenic
1171902596 20:30871194-30871216 TTGATGAAGATGAGTGAAGATGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172621799 20:36322254-36322276 TCAGGGAAGAGGAAGGAAGATGG + Intronic
1172638791 20:36428485-36428507 TTGGAGAAGCTGGTGGAAGCTGG + Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1173537685 20:43828546-43828568 GTGGAGAAGAGGGAGGAAAAGGG + Intergenic
1173860604 20:46280830-46280852 TTGGAGAAGCTCTTGGAAGAGGG - Intronic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1174718171 20:52782901-52782923 TGGGACAAGATGAAGAAGGATGG - Intergenic
1174829393 20:53798677-53798699 TGGGAGGACATGAAGGAAGAGGG - Intergenic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176349381 21:5779780-5779802 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176356195 21:5900364-5900386 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176543702 21:8177850-8177872 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176562653 21:8360895-8360917 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176671555 21:9739510-9739532 TGGGAGAAGAAGAAGAAAGAAGG + Intergenic
1177070641 21:16502345-16502367 TAGGAGAAGCTGAAGAAAAAGGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177388229 21:20434038-20434060 TTGGAGGAGAAGAAGAAATACGG - Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177616591 21:23529805-23529827 TTGGTGAAGATGTGGGAAAAAGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178056820 21:28808317-28808339 TTGGAAAAGAAGAAGAAAGTTGG - Intergenic
1178229235 21:30762050-30762072 TTGGACATGATGAAAGAGGAAGG - Intergenic
1178345936 21:31828044-31828066 CTGGACAAGATGGAGAAAGAGGG + Intergenic
1179024846 21:37671392-37671414 TGGGAGAAGAGGCAAGAAGAGGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180319221 22:11305410-11305432 TTGATGAAGATGAGTGAAGACGG - Intergenic
1180335986 22:11577162-11577184 TTGATGAAGATGAGTGAAGATGG + Intergenic
1181118270 22:20647845-20647867 GGGGAGAGGGTGAAGGAAGAAGG - Intergenic
1181868936 22:25882678-25882700 TTGGGGAAGATGAAGTGGGAAGG - Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182505293 22:30777883-30777905 TTGGAGGAGAGGGAGGAAGAAGG + Intronic
1182725579 22:32442550-32442572 TTGCAGAATATGAAGCAGGATGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183469500 22:37998029-37998051 TTGGGGAAGAGGCAGGGAGAGGG + Intronic
1183789662 22:40056019-40056041 TAGGAGTAAATGAAGGAAAATGG - Intronic
1184612019 22:45610311-45610333 TTGGGGAGTATGAAGCAAGATGG + Intergenic
1184881987 22:47312395-47312417 TTTCAGAAAATGAAGGAAAAAGG - Intergenic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1185136506 22:49076352-49076374 TTAGAGATGACGAAGGGAGAAGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
1203248570 22_KI270733v1_random:94072-94094 TTGCAGAGGATGATGGAGGAAGG - Intergenic
949134502 3:546733-546755 TTGGACAAGAAGAAGGAAAGGGG + Intergenic
949385154 3:3493614-3493636 TTGGTGAAGATGCAGAAAAAAGG + Intergenic
949621100 3:5812310-5812332 TTGGGAGAGATGAAGGAAGCAGG + Intergenic
950170060 3:10832847-10832869 TTGTAGAAAATGTAGGAAGTAGG + Intronic
951149342 3:19269047-19269069 TTAGAGAAGATGAAGGACTAGGG + Intronic
951611480 3:24495621-24495643 TTGGAGAAGAGGAAAGAATGGGG + Intergenic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
951860610 3:27247906-27247928 TTGCAAAAAATGGAGGAAGAGGG - Intronic
952055063 3:29434313-29434335 TTGGAGAAAAGGAGGGAACAAGG + Intronic
952541557 3:34372863-34372885 TGTGGGAAGAAGAAGGAAGATGG + Intergenic
952931296 3:38362952-38362974 TTGGAGAAGATGAAGGCTTCGGG + Exonic
952996728 3:38890196-38890218 GTGGGGAGGATTAAGGAAGAAGG + Intronic
953395091 3:42562708-42562730 TGGGAGAAGAGGAATGGAGATGG - Intronic
953535195 3:43771805-43771827 TTAGAGAAGAGGCTGGAAGAAGG - Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
953591795 3:44264166-44264188 TTGGAGTAGAGGAAGGAATGGGG - Intronic
953833855 3:46326438-46326460 TTTGAGGACATGAACGAAGAAGG + Intergenic
953998322 3:47537123-47537145 TGGGAGAAGAGGAAGGAGGTGGG + Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954065791 3:48104866-48104888 TTGGAGCAGGTGAAAGAACAGGG + Intergenic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955838377 3:63084047-63084069 TTTGTGAAGATGAAGCAGGAAGG + Intergenic
956109734 3:65858634-65858656 TTGGAGAAGAGGAAAGGAGGAGG + Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
957369359 3:79272338-79272360 TGGGAGATGATGGAGCAAGATGG + Intronic
957541128 3:81570462-81570484 AGGGAGAAGATGAAGGTTGATGG + Intronic
957766859 3:84636761-84636783 CTGGTGAGGATGCAGGAAGAAGG - Intergenic
957849188 3:85783430-85783452 TGGGAGGAGATGAAGGAAAAAGG + Intronic
957932881 3:86904831-86904853 ATGGAAAAAACGAAGGAAGAAGG + Intergenic
958421149 3:93933163-93933185 TTGGATGAGGTGAAGGAAAATGG + Intronic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
958621188 3:96563439-96563461 TTGGAGAAGATGCTTAAAGATGG - Intergenic
958735093 3:97999889-97999911 GTGGAGAAGGTGAAGGAAGGAGG + Intronic
958833545 3:99117654-99117676 TTGGGCAATAGGAAGGAAGAAGG + Intergenic
958896281 3:99833109-99833131 TTGGAGGAGATTAAGCAAGTTGG + Intronic
958965947 3:100558398-100558420 TTGTAGAAGATAAAGGCTGATGG - Exonic
958991379 3:100849631-100849653 CTGGACATGATGAAGAAAGATGG - Intronic
959133911 3:102392583-102392605 TGGCAGAAGAAGAAGAAAGAAGG - Intronic
959172306 3:102858162-102858184 TGTCAGAAGAAGAAGGAAGAAGG - Intergenic
959207094 3:103323234-103323256 TACCAGAAGAGGAAGGAAGAGGG - Intergenic
959237768 3:103746503-103746525 TTGGAGAAGAGGTATGTAGATGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959357599 3:105352763-105352785 TTGGAGAAGATGAATACAGGTGG - Intergenic
959388748 3:105746481-105746503 CTGGAGAAGATGCAGAAAGTGGG - Intronic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959931154 3:111984417-111984439 GTAAAGAAGATGATGGAAGAAGG + Intronic
960270026 3:115663453-115663475 TGGGAGAAGAGGGAGGGAGAGGG - Intronic
960429622 3:117552861-117552883 TTGGAGAACACTAAGAAAGAAGG - Intergenic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
961022808 3:123523428-123523450 TTTGTGAAGATGAAGTGAGAAGG - Intronic
961070993 3:123926701-123926723 TTGGAGAAGGAAAAGAAAGAGGG + Intronic
961076190 3:123984870-123984892 TTTAAGCAGATGAAAGAAGAAGG - Intronic
961225822 3:125244891-125244913 TTGGAGAGGTTGAAGGAGTATGG - Intronic
961575440 3:127832135-127832157 TTGTGAAACATGAAGGAAGAAGG + Intergenic
961796254 3:129411192-129411214 CTGGAGGAGATGGAGGAAGTGGG - Exonic
961956146 3:130805778-130805800 TTTGACAAGTTGAAAGAAGAAGG + Intergenic
962125895 3:132617398-132617420 ATTGAAAAGATGAAGGAAGGAGG - Intronic
962148015 3:132861615-132861637 ATGGAGAAGAGTAAGGCAGAAGG + Intergenic
962390009 3:134963181-134963203 GTACAGAAGAAGAAGGAAGAAGG - Intronic
962459525 3:135596533-135596555 GTGGAGAAGATGAGGGGTGAGGG + Intergenic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
962616870 3:137135273-137135295 TGGGAGAGTATGAAGGCAGATGG - Intergenic
962713447 3:138107001-138107023 TTGGAGAAGATGCAAGGGGAAGG + Intronic
962830642 3:139136318-139136340 TTGGAGTGGATGTAGGAGGAAGG + Intronic
962918779 3:139933326-139933348 TTAGAGAAAATGAAGGGAGGAGG + Intergenic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
963646125 3:147917000-147917022 TAAGAGAAGAAGAAGGGAGAAGG - Intergenic
963780943 3:149485889-149485911 TTGGAAGAGATGAAGAATGAAGG + Intronic
964028306 3:152105038-152105060 ATGGAAAAGAGGAAGGAAAAGGG - Intergenic
964366144 3:155952658-155952680 TTGGCAAAGAAGAGGGAAGATGG + Intergenic
964657280 3:159081625-159081647 TTGGAGAAGGTGATGGAAATGGG - Intronic
964708474 3:159646473-159646495 AAGGAGAGGATGAAGGAAGGAGG - Intronic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965346148 3:167553259-167553281 ACGGAAAACATGAAGGAAGATGG + Intronic
965701791 3:171465511-171465533 TCGGAAGAAATGAAGGAAGAAGG + Intergenic
966211721 3:177460239-177460261 TGGGAGGAGGGGAAGGAAGAAGG + Intergenic
966656201 3:182361243-182361265 AGTGAAAAGATGAAGGAAGAGGG - Intergenic
966846326 3:184133566-184133588 TTGGATAGGATGAAAGAAGTAGG + Intergenic
966942184 3:184754264-184754286 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
966942239 3:184754480-184754502 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
966985863 3:185179755-185179777 TTTGAGTAGGTGAAGGGAGATGG + Intergenic
967094738 3:186168055-186168077 GTTGAAAAGAGGAAGGAAGAAGG + Intronic
967117643 3:186356080-186356102 TTGAAAAAGATGAAGAAATATGG + Intronic
967131790 3:186477269-186477291 GGAGAGAAGATGTAGGAAGAGGG + Intergenic
967225316 3:187285568-187285590 TTTGAGAACAGGAAGAAAGAAGG + Intronic
967793614 3:193574818-193574840 TTGGTGAGTATGAAGCAAGAGGG + Intronic
968080649 3:195844154-195844176 TTGGAGAAGATGAAGAGAAAAGG + Intergenic
968783466 4:2600725-2600747 TTGAAGAAGATGAAAACAGATGG - Intronic
969239548 4:5889524-5889546 GGGGAAAAGATGAAAGAAGATGG + Intronic
969355137 4:6620710-6620732 TTGGAAAGAAGGAAGGAAGATGG + Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
969995071 4:11303575-11303597 CGGGAGAAGAACAAGGAAGAAGG - Intergenic
970229277 4:13891962-13891984 TCAGAGAAGATGCAGGAAGTTGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970696949 4:18689383-18689405 ACGGAGAAATTGAAGGAAGAGGG - Intergenic
970802117 4:19985176-19985198 TTGAAAAAGATGAAGAAAGTGGG - Intergenic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
971230766 4:24799116-24799138 TGGGGGAGGATGGAGGAAGAGGG + Intronic
971553973 4:27988845-27988867 TGAGGGAAGATAAAGGAAGAGGG - Intergenic
971924216 4:32985803-32985825 TATGTGAAGATGAAGGATGAAGG + Intergenic
971939304 4:33193579-33193601 GTGGTGATGATGAAGGCAGAAGG + Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972827065 4:42771220-42771242 TTCCAGAAGATAAAGAAAGAGGG + Intergenic
974164463 4:58183797-58183819 TTTGTGAATATGAAAGAAGAGGG - Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975217991 4:71779394-71779416 TTGGAGTAGATGCCTGAAGAAGG + Intronic
975259551 4:72280712-72280734 ATGAAGAAGATGAGGAAAGATGG - Intergenic
975726811 4:77300477-77300499 TTTGAAAAGATGAGAGAAGAAGG - Intronic
975892530 4:79046688-79046710 TTGGAGAAAAGGAGGAAAGAGGG - Intergenic
976026029 4:80688700-80688722 TTTGAGAAGCTGAGAGAAGAAGG + Intronic
976400708 4:84603449-84603471 TTGTAGAAGAGGAAAGAACATGG + Intronic
976480238 4:85534550-85534572 TTGGAGAAGATGAAGTGGGGTGG + Intronic
976842744 4:89451001-89451023 TTGCATAAGATGAAGAAGGAAGG + Intergenic
977181676 4:93882632-93882654 TTGGACAAATTGAAGAAAGATGG - Intergenic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978217969 4:106229919-106229941 TTAGGGAAGTTGAAGAAAGAGGG + Intronic
978303648 4:107297839-107297861 TTGTAGAAGAAGAACAAAGATGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
978951165 4:114561410-114561432 TAGGAGATGGTGCAGGAAGAAGG + Intergenic
978966069 4:114743199-114743221 TGGGAACAGATGAAGTAAGAGGG + Intergenic
979041283 4:115799922-115799944 TTGGATAAGATCAAGGAAGAAGG - Intergenic
979283739 4:118897424-118897446 TTAAACAGGATGAAGGAAGAGGG - Intronic
979453077 4:120895556-120895578 ATGAAGAAGATGAGGGCAGAGGG - Intronic
979712994 4:123802847-123802869 GGGAAGAAGAGGAAGGAAGACGG - Intergenic
979757093 4:124354483-124354505 TTGAAGAAGAAGAAGAAAGTTGG - Intergenic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
980086526 4:128396361-128396383 TTGGACAAGATGAATAAGGAAGG - Intergenic
980297170 4:130936028-130936050 TTGGAAAGGAAGAAGAAAGACGG - Intergenic
980476192 4:133320573-133320595 ATGTAGAACATTAAGGAAGAAGG - Intergenic
980512161 4:133807827-133807849 TTTGAAAAGATGAAGAAGGATGG + Intergenic
980687301 4:136244666-136244688 TTGGAGAGGATGAAGAGAAATGG + Intergenic
980901496 4:138909513-138909535 TTGGGGAAGATGATGCAAAATGG - Intergenic
980963943 4:139502524-139502546 GTGGAGCACAGGAAGGAAGAGGG + Intronic
981032923 4:140143991-140144013 TTTGAAAATATGAAAGAAGATGG - Intronic
982207733 4:153009614-153009636 TTGGGGGAGATGAAGGAAAGTGG + Intergenic
982261487 4:153498126-153498148 TGGGAGAAGATGTAGGAGGATGG + Intronic
982374387 4:154673594-154673616 GGGGACAAGAGGAAGGAAGAAGG + Intronic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982477294 4:155868873-155868895 TTAGGGGAGATGAAGGAAAATGG - Intronic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
983924457 4:173384617-173384639 TTAGAGAATTGGAAGGAAGATGG - Intergenic
984036298 4:174672377-174672399 TTGGAGAGGAAGAAAGAAAAAGG - Intronic
984042516 4:174752951-174752973 ATGGAGAACATGAAGAAACATGG - Intronic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985679994 5:1250943-1250965 GAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986109811 5:4702620-4702642 CTGGAAAAGATGAATGTAGATGG - Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986598949 5:9452059-9452081 GTGGAAAAGGTGAAGGAAGTGGG - Intronic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
986693273 5:10331364-10331386 TTGGAGATGGTGAGGGAAGGAGG - Intergenic
986998255 5:13632291-13632313 TGGGAGCAGATGAAGTTAGATGG - Intergenic
987001942 5:13668579-13668601 TTGGTGAAGATCAATTAAGAGGG + Intergenic
987104747 5:14627065-14627087 TTGGAGAAAATGCAGAGAGAAGG + Intergenic
987725868 5:21699093-21699115 TTTGTGAAGAACAAGGAAGAGGG - Intergenic
988169896 5:27639871-27639893 TAGGAGAAGAAGAAAGAAAAGGG - Intergenic
988379204 5:30478784-30478806 ATAGAAAAGATGAAGGGAGAGGG - Intergenic
988657675 5:33229956-33229978 TTGAAAAAGATGATGGCAGATGG + Intergenic
988713666 5:33803511-33803533 TTGGAGAACATGAAAGTAGCTGG - Intronic
989125716 5:38050701-38050723 ATGCAGAAGAGGAAGGCAGAAGG + Intergenic
989299963 5:39879202-39879224 TTAGAGAAGTTGAAGAAAAATGG - Intergenic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
989563756 5:42880372-42880394 TAGGAGGAGGGGAAGGAAGATGG - Intronic
989998754 5:50867392-50867414 TGGAAGAAAATGAAGGAAAAGGG + Intergenic
990143991 5:52738025-52738047 TGGGAGAAGAAGTAAGAAGAAGG - Intergenic
990746681 5:58965779-58965801 TGGGAGAAAGTGAAGGAAGTTGG - Intergenic
990753433 5:59041734-59041756 TTGGTGAAGATGGAGGAAGGGGG - Intronic
990870837 5:60430363-60430385 CTGGAGTAGAGGGAGGAAGAGGG - Intronic
991012525 5:61898959-61898981 ATGGAGGAAATGAAGGTAGAGGG + Intergenic
991520261 5:67489306-67489328 TTTGGGAGGATGAAGGAATAAGG - Intergenic
991911384 5:71565300-71565322 GGGGAGATGATGAAGGATGAAGG + Exonic
992333951 5:75746175-75746197 TGAGAGAAGATGAAGGCAGCTGG + Intergenic
992368479 5:76117520-76117542 TTGCAGAAGATGAAGCATGGAGG + Intronic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992979688 5:82156048-82156070 TAGGAGAAGATGAAGGAATGGGG + Intronic
993174502 5:84466163-84466185 ATGGAGCAGATAAAGGAAGGTGG + Intergenic
993715059 5:91268322-91268344 CAGGAGAAGATGAAAGAAAAAGG - Intergenic
993827398 5:92708755-92708777 TAAGAGAAGAGGAAGGCAGAGGG + Intergenic
993919445 5:93782136-93782158 TTGGAGAAGATCACTGAATAGGG + Intronic
994114424 5:96046151-96046173 GGGGAGGAGATGAAGTAAGAGGG + Intergenic
994659928 5:102641463-102641485 TTGGACCAGATGAAGCCAGAGGG + Intergenic
995022943 5:107386238-107386260 TTTGAGATGATCAAGGGAGATGG + Intronic
995094441 5:108218562-108218584 TTGGTGAGGATGTAGGAAAAGGG - Intronic
995322781 5:110856018-110856040 TGGAAAAAGATGGAGGAAGATGG - Intergenic
995394616 5:111674037-111674059 TCGGAGCAGAGGAAGGGAGAAGG + Intronic
995594039 5:113729828-113729850 TTGGAGTACATGAAGGAGAAGGG - Intergenic
995749054 5:115434866-115434888 TGGGAGACGAAGCAGGAAGATGG + Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996177336 5:120375491-120375513 ATGGAAAAAATGAAGCAAGAAGG + Intergenic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996760756 5:126983860-126983882 ATGAAAAAGATGAAGGAAGCTGG - Intronic
996924129 5:128802816-128802838 TTGGAGATGGTGAACAAAGAGGG + Intronic
997289015 5:132710972-132710994 TTGGAGAAGATGGAGAGAAAAGG - Exonic
998731729 5:145085019-145085041 TTGGAGTAGATGACGTCAGAGGG + Intergenic
998855175 5:146387733-146387755 TTTGAGGAGAAGAAGGAAGGAGG - Intergenic
998975863 5:147646036-147646058 TGGGAGAAGAGCAAGGAAAAAGG + Intronic
999189405 5:149735376-149735398 TTCCAGAGGAAGAAGGAAGAGGG - Intronic
999297985 5:150472562-150472584 TGGGAGAAGCTGAGGGAAGCAGG - Intergenic
999443895 5:151623516-151623538 TTGGGGAAGCTGAAGCAAGAGGG + Intergenic
1000083397 5:157868255-157868277 TGGGAGAAGATAAAGGGACATGG - Intergenic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000497717 5:162006439-162006461 TTGGAATAGCTGAAGGAAAATGG + Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000828045 5:166070538-166070560 TTGGAGGAGGTGAGGGTAGATGG - Intergenic
1001041908 5:168342225-168342247 TTGGAGCAGAGGAAGGGAGAGGG + Intronic
1001191558 5:169637238-169637260 TTTGAAAAGAGGAAGGAAGTGGG + Exonic
1001196309 5:169676371-169676393 TGGGAGAAAAAGAAGAAAGAGGG + Intronic
1001551150 5:172603050-172603072 TTGGAGAAGACAAAGAAACAGGG + Intergenic
1001767032 5:174257910-174257932 TTGGACAAGAGCAAGGAAGAAGG - Intergenic
1001959155 5:175869962-175869984 TTGAAGCACATGAAGAAAGAGGG + Intronic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002811315 6:632528-632550 ATGGATAAAATGAAGGAAAAGGG + Intronic
1002949342 6:1793697-1793719 TTGCAGAGAATGAAGGAAAAGGG - Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003268251 6:4585457-4585479 TGGGAGAAGAAGAGGGGAGAAGG - Intergenic
1003649679 6:7948163-7948185 TTTGACAAGTTGAGGGAAGAAGG - Intronic
1003781021 6:9426896-9426918 GTGATGAAGATGAAGTAAGATGG + Intergenic
1003995836 6:11538269-11538291 TCGGGGAAGATGAAGGCGGAGGG + Exonic
1004126701 6:12881228-12881250 ATGGTGAATATTAAGGAAGAGGG + Intronic
1004126840 6:12882285-12882307 TTGGAGATGATTAAGAAATAGGG + Intronic
1004394938 6:15239413-15239435 TTGGAGAGGATGACAGAAGAAGG + Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006140039 6:31922985-31923007 TTGGACAAGATGGAAGAAGCTGG + Intronic
1006175174 6:32117132-32117154 TTGGAGAGGGTGAAGGGAAAAGG + Intronic
1006268478 6:32945196-32945218 TTGGAGAGGAGGAAGGCAGTTGG + Intronic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007129377 6:39455527-39455549 TTTGACGAGCTGAAGGAAGAAGG + Intronic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1008318528 6:50077775-50077797 TTTGAGAAGTTGACAGAAGAAGG - Intergenic
1008517316 6:52330350-52330372 TTGGAGAAAGTGAAGGGTGAGGG + Intergenic
1008551041 6:52631018-52631040 ATGGAGAATATGAGGGAATACGG - Intergenic
1008857226 6:56104224-56104246 TTGGAGTATATCAAGGAAGGAGG + Intronic
1008874245 6:56308250-56308272 TGGCAGAAGATGGAAGAAGATGG - Intronic
1008874965 6:56315650-56315672 AGGGAGAGGAGGAAGGAAGAGGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010144119 6:72646184-72646206 TTTGAGAAGATGTAGTATGATGG - Intronic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011160832 6:84388640-84388662 TTGGAGAGGATGAATTAGGAGGG + Intergenic
1011300165 6:85865317-85865339 CAGGAGAAGAGCAAGGAAGAAGG - Intergenic
1011490291 6:87884566-87884588 TTGGAGAAAAGGCAGGATGAAGG + Intergenic
1011857042 6:91706017-91706039 TGGGACAGGATGAAGGAAGTAGG + Intergenic
1012161951 6:95896724-95896746 TTGAAGAAGATAAAGTACGAAGG - Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013345423 6:109255596-109255618 TTGGGGGAGATGAAAGAAGTAGG + Intergenic
1013662159 6:112308787-112308809 TTGGAGAAGGTGAAGCATGGTGG + Intergenic
1013760515 6:113512136-113512158 CTGGAAAAGAGGAAGAAAGAGGG - Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014229699 6:118889555-118889577 TTATAAAACATGAAGGAAGATGG + Intronic
1014278964 6:119419037-119419059 TTGGAGAAGATGAAGCATTCTGG - Intergenic
1014489649 6:122046065-122046087 TTGCAGAAGAAAAAGGAAGCTGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014862247 6:126484514-126484536 GGGGAGAAGATGGAGCAAGATGG + Intergenic
1014886124 6:126783814-126783836 TAGGGGAAGATAAAGGAAAAGGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015478025 6:133675319-133675341 AAGGAGGAAATGAAGGAAGAAGG + Intergenic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016606915 6:145940098-145940120 TTGAATAAGATTAAGGTAGAAGG + Intronic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016646203 6:146411379-146411401 CTGGAGCAGAGGAAGTAAGAAGG + Intronic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1017214651 6:151896218-151896240 TTCCACAAGATGAAGAAAGAGGG - Intronic
1017595189 6:156020910-156020932 TTGGAAAAGATGAAGTAGGTTGG + Intergenic
1018448905 6:163886997-163887019 TTGGTAAAGATGGAGTAAGAGGG + Intergenic
1018470087 6:164087204-164087226 CTGGAGAAGATGCACAAAGAAGG + Intergenic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1018830997 6:167443509-167443531 GTGGGGAAGATGAAGGGTGAGGG + Intergenic
1018842614 6:167528807-167528829 TTGGAGAAGGTGAAGGAGTTAGG - Intergenic
1018976415 6:168570917-168570939 TTGGAAAAGATGAAGGGATGAGG - Intronic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019748726 7:2715365-2715387 TTGCAGAAGATGAAGGAAATCGG - Exonic
1019768833 7:2870776-2870798 GAGGAGAAGAGGAAGGAAGGAGG + Intergenic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020290946 7:6721859-6721881 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020769087 7:12365043-12365065 GTGCAAAAGATGAAGAAAGATGG + Intronic
1020985834 7:15133364-15133386 GTGGAGACAATAAAGGAAGATGG + Intergenic
1021595464 7:22311925-22311947 TTTGAGAATATGAATTAAGATGG - Intronic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1022318391 7:29265175-29265197 CAGGAGAAGTTGAAGGAATAGGG - Intronic
1022577498 7:31512098-31512120 TTAGAGAAGGCTAAGGAAGATGG + Intergenic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1023071268 7:36436592-36436614 ATGGAAAAGATGTAGGAAAATGG - Intronic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023370276 7:39506124-39506146 TTGGAGACGGGGAAGGAAAAGGG - Intergenic
1023563548 7:41500674-41500696 TGGGAGAAGATGATGCAAGTGGG + Intergenic
1024798767 7:53051293-53051315 TTGGTGAAGCTGAAAGAAGCTGG - Intergenic
1026679851 7:72457602-72457624 TGGGAGAAGGAGGAGGAAGAGGG - Intergenic
1026748018 7:73027779-73027801 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1026751666 7:73055924-73055946 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1026755315 7:73084051-73084073 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1026758965 7:73112065-73112087 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1027034222 7:74913093-74913115 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1027088441 7:75281408-75281430 TTGACTAAGATGAAGGAAGGGGG + Intergenic
1027092084 7:75309336-75309358 TTGACTAAGATGAAGGAAGGGGG + Intergenic
1027095727 7:75337303-75337325 TTGACTAAGATGAAGGAAGGGGG + Intergenic
1027323613 7:77030383-77030405 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1027409625 7:77901378-77901400 TTTGGGAAGCTGAAGGCAGAAGG + Intronic
1027479363 7:78675779-78675801 TTGGAAAACAAGAAGGATGATGG - Intronic
1027557568 7:79685373-79685395 TAGGAGAAAATAATGGAAGAGGG - Intergenic
1028229484 7:88289296-88289318 ATGGAGAAGAGTAAGAAAGAAGG + Intronic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1029797584 7:102911150-102911172 TTGGAGGAGGTGAAGCAAGATGG - Intronic
1029930580 7:104366287-104366309 TTTGAGAAGATGGAGGAAGAGGG + Intronic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1030278615 7:107745682-107745704 TTGGTGAAAATGAAGGAGAATGG + Intronic
1030476783 7:110044097-110044119 AGGGAGAAGATGGAGCAAGATGG - Intergenic
1030615673 7:111735731-111735753 TTCGATAAGATGCAGGAATATGG + Intronic
1030717508 7:112827360-112827382 ATTCAAAAGATGAAGGAAGAGGG - Intronic
1030773370 7:113502471-113502493 TTGCAGAAGGTAAGGGAAGAAGG + Intergenic
1031435135 7:121724320-121724342 TTTGAGGAGTTGAGGGAAGAAGG - Intergenic
1031610642 7:123822714-123822736 TTTGAGAAGCTGAGGGATGAAGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032133390 7:129250485-129250507 TTGGACAAGAAGAAGTAAAATGG - Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032644346 7:133805816-133805838 TTTTATAAGTTGAAGGAAGAAGG + Intronic
1032681829 7:134192938-134192960 TGGGAACAGAGGAAGGAAGAAGG - Intronic
1033395788 7:140972659-140972681 TTGAAGATGATGAATAAAGAAGG + Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034015079 7:147574246-147574268 TTGGAGAAAACTAAGAAAGAAGG - Intronic
1034173165 7:149078926-149078948 GGGGAGAAGATGATAGAAGAGGG + Intronic
1034358127 7:150470178-150470200 ATGGAGAGGATGCAGGGAGAGGG + Intronic
1034427074 7:151019576-151019598 TAGAAGAGGATGAAGGAAGTAGG - Intronic
1034445380 7:151111366-151111388 TTCGAGGAGATGAGGGAGGATGG - Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1034859120 7:154581265-154581287 TTGGGGAAGGTGGAGGGAGAAGG + Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035136892 7:156712368-156712390 TTGGAGAGGATGCAGAAAAAAGG + Intronic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035814165 8:2520990-2521012 TGGTTGAAGAGGAAGGAAGACGG - Intergenic
1035917854 8:3644513-3644535 ATGGGGAAGATGATGAAAGAGGG + Intronic
1036170710 8:6481555-6481577 TGGGAGAGGAGGAGGGAAGACGG - Intronic
1036563054 8:9913800-9913822 TTAGAGAAGAGGCAGAAAGATGG - Intergenic
1036665389 8:10734059-10734081 GAGGAGAAGAGGGAGGAAGAGGG + Intronic
1036726435 8:11224879-11224901 TTGGAGAACATTATGGAGGAAGG - Intergenic
1037107215 8:15123947-15123969 TTGGGCAAGAGGAAGAAAGAGGG + Intronic
1037202600 8:16276122-16276144 TTGGTGGAGATGAAGGAACTGGG + Intronic
1037478453 8:19280300-19280322 TTAGACAAGAGGAAGGCAGATGG - Intergenic
1037626206 8:20609263-20609285 TTTGAGAAGGTGAAGGAAAATGG + Intergenic
1038008057 8:23450979-23451001 ATTTGGAAGATGAAGGAAGAGGG - Intronic
1038046628 8:23770992-23771014 ATGGGGAGGATGAAGGAAGGGGG + Intergenic
1038712373 8:29959389-29959411 AAAGAGAAGATGAAGGAAGAGGG + Intergenic
1038970937 8:32634372-32634394 ATCAACAAGATGAAGGAAGAAGG - Intronic
1038995473 8:32918258-32918280 TTGGAGAAGGTGAGAGACGATGG + Intergenic
1039180913 8:34864959-34864981 TTGGAGACCTTGAAGGATGAAGG - Intergenic
1039632097 8:39123288-39123310 TTGGAAAAGATGAATAATGAAGG - Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040478836 8:47805267-47805289 TTGGAGAAGATGGGGGAAACTGG - Intronic
1040559131 8:48508468-48508490 TTGGAGATGATAAAGGAGGGTGG + Intergenic
1040835227 8:51723955-51723977 GTGGAGAAGAGGAAATAAGATGG + Intronic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041203884 8:55477563-55477585 TTTGACAAGATGAGAGAAGAAGG + Intronic
1041311517 8:56522365-56522387 TTGTAGAAGATGGAGGCAGAAGG + Intergenic
1041428658 8:57752618-57752640 TTAGAGAAGTTAAAGGTAGAGGG + Intergenic
1041496073 8:58486630-58486652 TTGGAGAAGAGCAAGGAATGGGG - Intergenic
1041617069 8:59919654-59919676 TTAAAGAAGATGAAAGAAAAGGG - Intergenic
1041877675 8:62709256-62709278 TTCCACAAGATGGAGGAAGAAGG - Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042534990 8:69849927-69849949 TTGGAGAAAATTGAGCAAGATGG - Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042711490 8:71722462-71722484 TTTGAGAATAGGAAGTAAGAAGG - Intergenic
1043731820 8:83693485-83693507 TTGAAGAAGAGGATGGCAGAGGG + Intergenic
1044065370 8:87692492-87692514 TTGGAGAATATTAAGGACCATGG - Intergenic
1044072195 8:87776190-87776212 TTACAGAAGGTAAAGGAAGAGGG - Intergenic
1044114758 8:88321879-88321901 GGGGAGAAGTTGAAGGAAGTGGG - Intronic
1044384040 8:91566551-91566573 TAGATGAAGATGAAGGAAGGAGG - Intergenic
1044429429 8:92091154-92091176 TTGTAGAAGAGGAATGCAGAGGG - Intronic
1044448710 8:92308998-92309020 TTGGAGAGGATGTGGGAAAAAGG - Intergenic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1044656920 8:94557938-94557960 TTGGAAAAGAAAAGGGAAGATGG + Intergenic
1045050070 8:98315851-98315873 TTGAAGTAGATGAAGAAAGTTGG + Intergenic
1045061305 8:98413771-98413793 TCGGAGAAGATGGATGACGATGG - Intronic
1045133253 8:99182317-99182339 TTTGGGAGGATGAAGGAGGAAGG + Intronic
1045728060 8:105199477-105199499 TGGGAGAAGAGGGAGGCAGAGGG - Intronic
1045988978 8:108283944-108283966 TTGATGAATATGAAGGAGGACGG - Intronic
1046506296 8:115142030-115142052 TTGGAGAAAATGGGGGAAGAAGG + Intergenic
1046581752 8:116101888-116101910 TTGAGGGAGATAAAGGAAGAGGG - Intergenic
1046744767 8:117864895-117864917 TTGGAGAAGAGGAAGGAAGTAGG - Intronic
1046826456 8:118696743-118696765 TAGAAGAAAATGAAGGAATAAGG - Intergenic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047357877 8:124140541-124140563 TTGGAAAAAATGAAGGATAATGG + Intergenic
1047530921 8:125674580-125674602 GAGGAGAAGATGTATGAAGATGG - Intergenic
1047640903 8:126820878-126820900 TTGGAGAGGAAGAAGGGAGATGG + Intergenic
1047880686 8:129189643-129189665 TTTGAGAAGATGGATGAACAAGG + Intergenic
1048142037 8:131804118-131804140 TAGGAAAAGATGGAGGGAGAGGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048670262 8:136711388-136711410 CTGGAGAACATGTTGGAAGATGG - Intergenic
1048876642 8:138841678-138841700 TTGACGAAGAGGAGGGAAGAGGG + Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049929760 9:444995-445017 ATGAAGAAGATAATGGAAGAGGG + Intronic
1050369912 9:4910144-4910166 TAGGAGAGAAGGAAGGAAGAAGG + Intergenic
1050435662 9:5607228-5607250 TTGGAGAAGAACAAGGTAGGAGG + Intergenic
1050565209 9:6875124-6875146 CTGGAGAAGAGGAAGGAAACGGG - Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050838741 9:10118904-10118926 ATAAAGGAGATGAAGGAAGAGGG + Intronic
1051510599 9:17873835-17873857 TTGCAGACCATGAAGGAAGGTGG - Intergenic
1051700907 9:19822932-19822954 AAGGAGAAGAGGAAGGAAGGAGG - Intergenic
1055133336 9:72801080-72801102 TTGGAGAAAATCAAAGCAGAGGG - Intronic
1055291720 9:74788581-74788603 ATGCAGAAGATAAAGGTAGATGG + Intronic
1055378040 9:75671798-75671820 TTGAAGAAGAAGAGGGAAGGGGG + Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1055927923 9:81529883-81529905 TAGGAGCAGTTTAAGGAAGAGGG - Intergenic
1055965236 9:81859504-81859526 TTAGAGAAAAGGAAGGAAGGGGG - Intergenic
1055984563 9:82043932-82043954 TTGGAAAAGAAGAAGTAAAACGG - Intergenic
1056271277 9:84950253-84950275 TTTGATAAGATGCAGGAAGTTGG + Intronic
1057497998 9:95575304-95575326 GAGGAGAAGAGGGAGGAAGAAGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057939626 9:99270392-99270414 TTGGTGGATATGAAGGAAGCAGG + Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058717741 9:107737912-107737934 GTGGGGAAGATGAAGCTAGAAGG + Intergenic
1058978622 9:110148451-110148473 AAGGAGGAGATGAAAGAAGAAGG + Intronic
1059164267 9:112063819-112063841 GTTGAGAAGATTAAGTAAGATGG - Intronic
1059266115 9:113032616-113032638 GAGCAGAAGATGAAGGAAGGCGG + Intergenic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1059598656 9:115751658-115751680 TTGGAGAAGACCGAGGAAAAGGG + Intergenic
1059656075 9:116358714-116358736 GAAGAGAAGAGGAAGGAAGAGGG - Intronic
1059761247 9:117339754-117339776 AGGAAGAAGGTGAAGGAAGAAGG + Intronic
1059860672 9:118457564-118457586 CTGGAGGGGATTAAGGAAGAGGG - Intergenic
1059974401 9:119700202-119700224 TGGGAGAAGATGAGGGAAGGTGG - Intergenic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1060404137 9:123364770-123364792 ATGGTGAAGAGGAAGGGAGATGG - Intronic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1061081582 9:128374032-128374054 TTGGGGGGGTTGAAGGAAGATGG + Intronic
1061111456 9:128574714-128574736 TTGGAGAAGATGCGAGAAAAAGG + Exonic
1061566708 9:131445582-131445604 TTGGAGAAGATGAGAAAACATGG + Intronic
1062477521 9:136736121-136736143 GGGGAGGAGAAGAAGGAAGAAGG - Intergenic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1062643216 9:137532819-137532841 CTGGAGAAGGTGAAGCAAGCAGG + Intronic
1203464971 Un_GL000220v1:77320-77342 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1203367448 Un_KI270442v1:271159-271181 TTGATGAAGATGAGTGAAGACGG - Intergenic
1203370866 Un_KI270442v1:303134-303156 TTTGAGGAGATGAGAGAAGAAGG + Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1186462688 X:9760924-9760946 TAGGAAGAGAGGAAGGAAGAAGG + Intronic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1186593878 X:10960069-10960091 TTAGAGAATATGAAGGCATATGG - Intergenic
1186919497 X:14262513-14262535 TTTGGGTAGAAGAAGGAAGAGGG - Intergenic
1187500384 X:19833764-19833786 AGAGTGAAGATGAAGGAAGAAGG - Intronic
1187575957 X:20555547-20555569 TTGGAAAAGAAGAACAAAGAGGG + Intergenic
1187652218 X:21421470-21421492 TTGGAGGAGGTGGAGCAAGATGG - Intronic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187850083 X:23583104-23583126 TTTGGGTAGAAGAAGGAAGAGGG + Intergenic
1188129609 X:26415064-26415086 CTAGAGAAGATGGAGGAAAAGGG + Intergenic
1188755087 X:33952570-33952592 TTGGTGAAAATGAAGGGGGAGGG + Intergenic
1189087240 X:38038415-38038437 TTGGAGGATATCAAGGAAAAAGG - Intronic
1189128230 X:38471072-38471094 TTGGAGAAGATGTGGGATAAAGG + Intronic
1189214458 X:39311220-39311242 TTGCAGGAAATGAAGTAAGAAGG + Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1190000423 X:46681263-46681285 TTGGATAAGATGGGGGAAAAGGG - Intronic
1190040616 X:47068554-47068576 TAGGAAAACATGAAGGAAGCAGG - Intergenic
1190148913 X:47924561-47924583 TGGTAGAAGATGAATGTAGAAGG - Intronic
1190624147 X:52320156-52320178 TTGGAGAATATGAAGGATAATGG - Intergenic
1190750405 X:53357106-53357128 TGGCAGAAGATGAGGAAAGAAGG + Intergenic
1190776247 X:53554591-53554613 TTGGGGAGGATGAAACAAGAGGG - Intronic
1190778299 X:53573059-53573081 TTGGTGAAGTTGGAGGAAAATGG - Intronic
1191681026 X:63839788-63839810 TTGGACAAGTTGAGAGAAGAAGG + Intergenic
1191855432 X:65621547-65621569 TTGAAAAAGATGAAGAAAGTTGG - Intronic
1191868524 X:65725604-65725626 TTGCAGAGGATGAAGGTAGTGGG - Intronic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192577906 X:72257646-72257668 TTGAAGATGATCAAGGAGGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193624716 X:83804021-83804043 ATGGAGATGATGAAGAAAAATGG + Intergenic
1193656678 X:84206748-84206770 CAGGAGAAAATAAAGGAAGAGGG - Intergenic
1193860404 X:86659067-86659089 TTGGATAACATAAAGAAAGAAGG - Intronic
1194858013 X:98957473-98957495 GGGGAGAAGATGGAGAAAGATGG - Intergenic
1195038059 X:100988179-100988201 GTGGAGAAGCTGGTGGAAGATGG - Exonic
1195530565 X:105950500-105950522 ATGGAGAAAATAAAGGAAAAAGG + Intronic
1195785700 X:108519538-108519560 TGGGAGGAGATGGTGGAAGAGGG - Intronic
1196015650 X:110937631-110937653 TGGCAGAAGATGAGGGAAGCTGG - Intergenic
1196736626 X:118986302-118986324 TGGGAGAAGAGGGAGGAAGCTGG + Intronic
1196981616 X:121220659-121220681 GTGAAGAAGATGAAGAATGAGGG - Intergenic
1197104880 X:122702246-122702268 TTGAAGGAGATGAAGAAAAATGG + Intergenic
1197187238 X:123601429-123601451 TAGGAGAAAAGGAAGGGAGAAGG + Intronic
1197424230 X:126275151-126275173 TTGGGGAGGATGAAGAATGAAGG - Intergenic
1197670729 X:129274069-129274091 TGGGAGAAGATGGAGCAAGATGG - Intergenic
1197795216 X:130291075-130291097 TTGGGGAAGAAAGAGGAAGATGG - Intergenic
1197815466 X:130493757-130493779 TTGGAAAAGAAGCAGTAAGATGG + Intergenic
1197859658 X:130956800-130956822 TGAGAGAAAATGAATGAAGAGGG + Intergenic
1198052847 X:132965135-132965157 CTGGAGAATTTGAAGGAAGCAGG + Intergenic
1198145484 X:133852293-133852315 TTTGAGAGGAGGCAGGAAGATGG - Intronic
1198978011 X:142359021-142359043 CAGAAGAAGATGAAAGAAGAAGG - Intergenic
1199073939 X:143509520-143509542 CTGGAGAAGATGAAAGAATAAGG - Intronic
1199074024 X:143510038-143510060 CTGGAGAAGATGAGAGAATAGGG - Intronic
1199563242 X:149186705-149186727 TCTGTGAAAATGAAGGAAGAAGG - Intergenic
1199680936 X:150224163-150224185 AAGAGGAAGATGAAGGAAGAAGG - Intergenic
1199842097 X:151659957-151659979 TTACAGAAGATGAAGAAAGTTGG - Intronic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1199963851 X:152801547-152801569 TTGGGGGAGAGGATGGAAGAGGG + Intergenic
1200147144 X:153932216-153932238 TTGGTGAAGATCCAGGAAGTGGG - Intronic
1200669378 Y:6068312-6068334 TTGGAGAAGAGGATGGAACTAGG + Intergenic
1200735543 Y:6789851-6789873 TTGGAGAACATGGATGAAGTTGG + Intergenic
1202189981 Y:22231647-22231669 AGAGAGAAGATGGAGGAAGAAGG + Intergenic
1202333511 Y:23780536-23780558 TTTGATAAGATGAAAGAAGAAGG - Intergenic
1202537258 Y:25889527-25889549 TTTGATAAGATGAAAGAAGAAGG + Intergenic