ID: 982477023

View in Genome Browser
Species Human (GRCh38)
Location 4:155866263-155866285
Sequence ATACTGTTATTGATGAAAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982477023_982477026 15 Left 982477023 4:155866263-155866285 CCAATTTTCATCAATAACAGTAT 0: 1
1: 1
2: 1
3: 32
4: 328
Right 982477026 4:155866301-155866323 TATATAAAATACAGCAGTTGAGG 0: 1
1: 0
2: 1
3: 30
4: 327
982477023_982477027 28 Left 982477023 4:155866263-155866285 CCAATTTTCATCAATAACAGTAT 0: 1
1: 1
2: 1
3: 32
4: 328
Right 982477027 4:155866314-155866336 GCAGTTGAGGTTGTAAAACATGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982477023 Original CRISPR ATACTGTTATTGATGAAAAT TGG (reversed) Exonic
903617439 1:24671214-24671236 ATACTTTTCTTGGTGATAATTGG + Intronic
907584647 1:55606270-55606292 ATACTGTTATTGTTCATAATAGG + Intergenic
908542430 1:65134359-65134381 ACACTTTTATCTATGAAAATGGG + Intergenic
908899216 1:68936603-68936625 ATACTGATATAGATGTGAATAGG + Intergenic
909221621 1:72969569-72969591 AAACTGTAAATGATGCAAATTGG - Intergenic
909251731 1:73365902-73365924 GTACTGTTATTTATGTATATTGG - Intergenic
909472329 1:76042334-76042356 AAAGTGTTTTTGATGTAAATAGG - Intergenic
909909237 1:81241370-81241392 ATACAATTATTGATGAGAAAAGG + Intergenic
910071123 1:83214465-83214487 ATGCTGCTATGGATGGAAATAGG + Intergenic
911282333 1:95945548-95945570 TTTCAGTGATTGATGAAAATTGG + Intergenic
911886738 1:103310958-103310980 ATAATGTTAATGATTATAATTGG + Intergenic
913561444 1:120024832-120024854 TTATTTTTAATGATGAAAATTGG - Intronic
913636684 1:120768770-120768792 TTATTTTTAATGATGAAAATTGG + Intergenic
914282029 1:146184241-146184263 TTATTTTTAATGATGAAAATTGG - Intronic
914429564 1:147608538-147608560 AGATAGATATTGATGAAAATTGG + Intronic
914543058 1:148634948-148634970 TTATTTTTAATGATGAAAATTGG - Intronic
914623564 1:149436064-149436086 TTATTTTTAATGATGAAAATTGG + Intergenic
915067202 1:153235078-153235100 ATGCTAGTATTAATGAAAATTGG + Intergenic
919660859 1:200244361-200244383 AAATGGTTATTGATCAAAATTGG + Intergenic
920750121 1:208666339-208666361 AGACTGATATTGATGAATCTTGG - Intergenic
920971369 1:210746083-210746105 ATCCTGTTATTGATAAATATGGG + Intronic
921640754 1:217550026-217550048 ATATTGGTATTTAGGAAAATAGG - Intronic
921759221 1:218893072-218893094 ATAATAATATTGGTGAAAATTGG + Intergenic
921795468 1:219338642-219338664 ATGATGTTGATGATGAAAATGGG - Intergenic
922058954 1:222069114-222069136 ATACTGTTAATGATTGACATGGG - Intergenic
923135430 1:231113816-231113838 GTACTGTAAGTCATGAAAATGGG - Intergenic
924203398 1:241684712-241684734 ATACTGATATTTTTGAAGATAGG - Intronic
1064194220 10:13232468-13232490 GGACTGTTTTTGATTAAAATGGG - Intronic
1065064307 10:21944546-21944568 ATACTGTGATTGATACAATTAGG - Intronic
1065235314 10:23644719-23644741 ATATTTTTATTGTTGCAAATGGG + Intergenic
1065616353 10:27529208-27529230 ATATTGTTAAGGATGAATATGGG + Intronic
1066616263 10:37298009-37298031 AGTGTGTCATTGATGAAAATAGG + Intronic
1067154369 10:43764317-43764339 TTACAGTTGTTGATGAAAAAAGG - Intergenic
1067260856 10:44690162-44690184 ATTTTGTTGTTGTTGAAAATTGG + Intergenic
1067992017 10:51224980-51225002 TTAGTGTTGGTGATGAAAATAGG + Intronic
1068434362 10:56971583-56971605 ATATTGTTATTTATGAAAAGTGG + Intergenic
1068825421 10:61433114-61433136 ATCTTGTTATTTAAGAAAATAGG + Intronic
1072771863 10:98147604-98147626 ATACTGAGAATGATGAAACTAGG - Intronic
1073961685 10:108938112-108938134 ACAGTGTTATTGATGATACTAGG + Intergenic
1074934995 10:118169561-118169583 ATCCAGGTATTGAAGAAAATAGG + Intergenic
1075433423 10:122410715-122410737 ATACTGTAATTTAAGAAAAATGG + Intronic
1076081580 10:127586376-127586398 ATTCTATTAGTGAGGAAAATGGG + Intergenic
1078658639 11:13266190-13266212 AAACTTTTATTCAGGAAAATGGG + Intergenic
1080030420 11:27655024-27655046 ATTATGTTATTGAAAAAAATTGG - Exonic
1080157992 11:29135399-29135421 ATACTGTTATTATTAATAATGGG - Intergenic
1080199049 11:29647265-29647287 ATACTGTTAGTTATAAAATTAGG - Intergenic
1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG + Intronic
1083967342 11:66050937-66050959 ATAGTGATATTGATGGAAAGGGG + Intronic
1085648890 11:78249006-78249028 ATCATGTTCTTCATGAAAATGGG + Intronic
1085921122 11:80958213-80958235 ATGCTGCTATTTATCAAAATTGG + Intergenic
1086174323 11:83871953-83871975 ATACTTTTATTTTTAAAAATTGG + Intronic
1087554559 11:99699477-99699499 ATTTTATTATGGATGAAAATGGG + Intronic
1088272991 11:108054597-108054619 ATACTGATTTTGATCATAATTGG + Intronic
1089521100 11:119064186-119064208 ATGCGGTTATTGACGAAAACTGG + Intergenic
1089965953 11:122655403-122655425 ATGCGGTTATTAATGGAAATTGG - Intergenic
1090214467 11:124949203-124949225 ATATTTTTATTAATCAAAATAGG + Intergenic
1092343662 12:7697688-7697710 CTACTCTTATTGTTGAAAAAAGG - Intergenic
1094010061 12:25798578-25798600 AAACTATTATTAATTAAAATTGG - Intergenic
1094318376 12:29157067-29157089 ATACTGGTGTTGATTAAAGTGGG - Intronic
1095552874 12:43464861-43464883 ATACTGATATTGATGTGAGTTGG - Intronic
1095745139 12:45649853-45649875 AAACTGTTATTCATTGAAATAGG - Intergenic
1096443182 12:51663664-51663686 ATTCTGTTATTCATGCAAGTAGG + Intronic
1097643950 12:62213976-62213998 ATACTGGTAATGATGCAAACTGG - Intronic
1098244162 12:68499174-68499196 CTTCAGTTATTGATGAAAATAGG + Intergenic
1099055243 12:77832043-77832065 ATACTGCAATGTATGAAAATAGG + Intronic
1099340800 12:81431343-81431365 TTATTGTTATTGCTTAAAATTGG - Intronic
1099687534 12:85908697-85908719 TTACTTTTATTGATGCATATTGG - Intergenic
1099925984 12:89018081-89018103 ATACTGTTTTTAAACAAAATTGG - Intergenic
1100080302 12:90841318-90841340 TTTCTGTTATTGATGACATTGGG - Intergenic
1100098449 12:91072979-91073001 ATATTGCTATTACTGAAAATGGG + Intergenic
1100151942 12:91749343-91749365 ATATTGATAATGATTAAAATAGG - Intergenic
1100651368 12:96593001-96593023 TTATTATTATTTATGAAAATGGG + Intronic
1101547026 12:105723953-105723975 ATAATGTTAATGATGACAATAGG + Intergenic
1102764078 12:115416366-115416388 ACACTGATAATTATGAAAATAGG - Intergenic
1103941388 12:124503153-124503175 ATTCTCTAATTGATGAGAATGGG - Intronic
1105345967 13:19573017-19573039 ATAATGTTATTGATAGGAATGGG - Intergenic
1105397557 13:20053711-20053733 TCACTGATATAGATGAAAATTGG + Intronic
1107161331 13:37232123-37232145 ATGCTGTTAATGATAATAATAGG - Intergenic
1107435202 13:40375647-40375669 ATAGTATTAATGTTGAAAATGGG + Intergenic
1107676532 13:42803406-42803428 AAAGTGTTATTTATGAAAACAGG - Intergenic
1107735916 13:43398575-43398597 TAACTTTTATTGAAGAAAATTGG - Intronic
1108133449 13:47329013-47329035 ATACTGTTAATGAATGAAATAGG - Intergenic
1108744792 13:53381590-53381612 ATATTCTTTTTGATGTAAATGGG + Intergenic
1109236026 13:59821762-59821784 AAACTGTTATCAATGAAAATAGG + Intronic
1110309221 13:74027923-74027945 ATACTGTTTTGGATTAAAGTGGG - Intronic
1110728104 13:78849643-78849665 ATACTGTAATTGCTGAACTTAGG + Intergenic
1111153203 13:84286423-84286445 ATATTGTTATTGTTAAAATTGGG + Intergenic
1111490406 13:88965775-88965797 ATTCTTTTATTGATGGAAACAGG + Intergenic
1111785505 13:92781956-92781978 ATATTATTATTCTTGAAAATTGG - Intronic
1111982150 13:95027669-95027691 ATATTGTTATTGTTTATAATGGG + Intronic
1112494932 13:99896658-99896680 ATACTGTGATTGAACAAAGTGGG - Exonic
1113535125 13:111060151-111060173 ATTCTTTTATTGAGGAAATTCGG - Intergenic
1113649122 13:112022647-112022669 ATACTTTTATTGCTAAAAAATGG - Intergenic
1114578416 14:23734343-23734365 ATTCTCCTATTGATGAATATTGG - Intergenic
1115483394 14:33884916-33884938 ATAGTGTTATTGAGCAAAAGGGG - Intergenic
1115776487 14:36720815-36720837 CTACTGCTATTTATGATAATGGG + Intronic
1116253976 14:42525583-42525605 ATACTGTATTTCTTGAAAATAGG - Intergenic
1124398936 15:29331635-29331657 ATGCTGTCATTGCTGAATATCGG - Intronic
1124910078 15:33911156-33911178 ATACTGTGAGTGATGAGAAGAGG - Intronic
1126504887 15:49393517-49393539 ATATTGTTAGTGGTGAAGATTGG - Intronic
1127375460 15:58380655-58380677 CCAATGTTATTGATGCAAATTGG - Intronic
1128196707 15:65763896-65763918 AAAATGTTATTGCTGACAATTGG + Intronic
1128230088 15:66028427-66028449 TTACTGATAATGTTGAAAATAGG + Intronic
1128626804 15:69216199-69216221 ATACTGCTAGTGCTGAAGATTGG + Intronic
1128697343 15:69778075-69778097 ATTTTGTCATTGTTGAAAATTGG + Intergenic
1129141128 15:73598862-73598884 ATACTGCTATGGATGTAAACAGG - Intronic
1130788455 15:87125772-87125794 CTACAGTTATTGATGGAGATTGG - Intergenic
1130857037 15:87849210-87849232 ATACTGTAATTAACAAAAATCGG - Intergenic
1131162999 15:90120923-90120945 ATTCTACTATTGATGAACATCGG + Intergenic
1133576915 16:7100453-7100475 ATTCTGTTTTGGAGGAAAATGGG - Intronic
1135786652 16:25355773-25355795 ATACTGTTATTAATCACAGTAGG + Intergenic
1137644556 16:50062814-50062836 ATACTGTGATGTGTGAAAATGGG + Intergenic
1138723644 16:59111331-59111353 AGACTGTTATTTATGACACTAGG + Intergenic
1141225341 16:82109681-82109703 GGACTGTTATTGAAGAAAAATGG + Intergenic
1141306416 16:82868253-82868275 AAACTCTTATTAATGTAAATAGG - Intronic
1141888075 16:86906819-86906841 ATCCTGTTATTAATGAGAGTTGG + Intergenic
1142665334 17:1459830-1459852 ATACTGCTGTTGATGAAGAGAGG - Intronic
1142947841 17:3448852-3448874 ATATTGATTTTGTTGAAAATTGG + Exonic
1145727893 17:27149487-27149509 ATACTTTTATTGTAGAATATAGG + Intergenic
1147199980 17:38794410-38794432 ATTATGTTATTGATGACCATGGG - Intronic
1150663433 17:67107198-67107220 ATACTGTTCGAGATGACAATGGG + Exonic
1151012850 17:70521035-70521057 ATACTGTTGTGGATGATATTGGG + Intergenic
1151229586 17:72674269-72674291 ATACTGTCACTGATGTAAAAAGG - Intronic
1153934629 18:9910578-9910600 ATACTATTAGTGATTCAAATAGG + Intergenic
1154983746 18:21528011-21528033 ATACTATTGTTTATGGAAATTGG + Intergenic
1155848406 18:30737930-30737952 ATTCTGATATTAATTAAAATTGG - Intergenic
1156058260 18:33038061-33038083 ATACTTTTATTGAAAAAACTGGG - Intronic
1156220355 18:35044659-35044681 ATACTGTTGTTACTGAAAAAGGG + Intronic
1156221361 18:35055592-35055614 ATACAGTTATTTATAAAAATGGG - Intronic
1156951215 18:42900662-42900684 ACACTGATATTAATGAAAAGAGG - Intronic
1157043153 18:44063175-44063197 ATACAGTTACTGATGGTAATTGG + Intergenic
1157119350 18:44894692-44894714 ATACTTTAATTGAATAAAATGGG - Intronic
1158207947 18:55014547-55014569 TTTCTGATATTGAGGAAAATAGG - Intergenic
1159155988 18:64582971-64582993 ATACTCTTAAGGATAAAAATGGG + Intergenic
1164327143 19:24205144-24205166 ACACTGTTTTTGTAGAAAATGGG - Intergenic
1164373689 19:27665749-27665771 ATACTCTTATTGTCGAAACTAGG - Intergenic
1164463388 19:28467202-28467224 ATCCTGCTATTGATGTAAATGGG + Intergenic
926790913 2:16570789-16570811 ACAATGTTACTGGTGAAAATGGG + Intronic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
928578771 2:32683795-32683817 TTCCTTTTATTGTTGAAAATGGG + Intronic
929279093 2:40058801-40058823 ATGCAGTTATTGCAGAAAATTGG + Intergenic
929324523 2:40592245-40592267 AAACTCTTTTTTATGAAAATGGG - Intronic
930187180 2:48421722-48421744 ATAATGTTTTTGATGAAATAAGG - Intergenic
930352239 2:50271766-50271788 GTACTGTTATTCACCAAAATAGG - Intronic
930865445 2:56118242-56118264 TTCCTGTTAATGAGGAAAATTGG + Intergenic
931483151 2:62663362-62663384 AAACTGTTCTTGATGCAAAAAGG + Intergenic
931562536 2:63578234-63578256 ATAATGATAATGCTGAAAATTGG - Intronic
931973987 2:67622696-67622718 AAGCTGTTATTAATGCAAATTGG + Intergenic
932043215 2:68320880-68320902 AAACTGTTAATGATAAAAGTGGG + Intergenic
932679494 2:73812288-73812310 ATATAGATATTAATGAAAATTGG - Intronic
934667259 2:96181158-96181180 CTACTGTTCTAGATGAAAAGTGG + Intergenic
935016488 2:99187500-99187522 AAACTGTTATTTACAAAAATAGG - Intronic
935352777 2:102168130-102168152 ATGCTGTAATTTATTAAAATAGG - Intronic
936487335 2:112937541-112937563 ATACTGTTAGTGACAAAAATAGG - Intergenic
937836546 2:126476561-126476583 ATAATGTTAATGATAAAAAATGG + Intergenic
938215768 2:129512333-129512355 GTACTGTGATTGCTAAAAATTGG - Intergenic
938640782 2:133276989-133277011 ACACTCTTCCTGATGAAAATAGG + Intronic
939325794 2:140686560-140686582 ATACTTTTATTGATGAAAATAGG + Intronic
939366214 2:141235189-141235211 ATATTGTGATTGATGATAAAAGG - Intronic
940351539 2:152695286-152695308 ATACTAATATAGATGAACATTGG - Intronic
941345901 2:164369238-164369260 ATCCTTCTATTTATGAAAATAGG + Intergenic
942826790 2:180187450-180187472 ACACTGTCATAGCTGAAAATCGG + Intergenic
943992754 2:194718559-194718581 GTACTATTATTTATCAAAATTGG + Intergenic
944138703 2:196430902-196430924 TTAATGTTTTTGATGAAATTTGG - Intronic
944181710 2:196902883-196902905 ATACTGATTTTACTGAAAATAGG - Intronic
944306731 2:198187828-198187850 TTATTGTCATGGATGAAAATGGG - Intronic
945316142 2:208372734-208372756 ATTCTATTAATGATGAAATTAGG + Intronic
945629036 2:212248451-212248473 ATACTGTCAATGATAAAACTTGG + Intronic
947561949 2:231162571-231162593 TTACTCTTTGTGATGAAAATGGG + Intronic
948184722 2:236011959-236011981 AAGGTGTTATTGATGATAATAGG + Intronic
1169880901 20:10345058-10345080 ATAACGTTATTGATTTAAATTGG - Intergenic
1170270334 20:14520539-14520561 CTACTTTTATTGATCAGAATTGG + Intronic
1171424595 20:25041728-25041750 AGACTGTTCTTGTTGAAAACGGG + Intronic
1172517645 20:35546201-35546223 ATACTGTTGAGGATGAAAATCGG + Intronic
1173156302 20:40613724-40613746 AAATGGTTATTGATGAAAAAGGG - Intergenic
1175231906 20:57479248-57479270 AAACTTTTAAGGATGAAAATAGG - Intergenic
1177452998 21:21296343-21296365 AAACTGTTATTTAGGAGAATAGG + Intronic
1178472825 21:32909077-32909099 ATACTGTTTTGGCTGTAAATGGG + Intergenic
1179242361 21:39603539-39603561 ATACTGTTAATGATAAAAAGGGG + Intronic
949694325 3:6676755-6676777 ATACTGGTATTAGGGAAAATGGG + Intergenic
950730158 3:14948981-14949003 ATGGTGTTATTGTTAAAAATGGG + Intronic
951792343 3:26500175-26500197 ATATAGTCATTCATGAAAATAGG + Intergenic
953108711 3:39911392-39911414 AAACTGTTATTAAAGAAAGTGGG - Intronic
955008809 3:54994565-54994587 TTACTGTTATTGCTGTAACTGGG - Intronic
955198128 3:56824634-56824656 ATACTGTTTTTGAAGATTATTGG + Intronic
955457696 3:59142168-59142190 ATACTGTTATTGTGGACAGTAGG - Intergenic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
956276126 3:67503034-67503056 AATCTGTTATTCATAAAAATAGG - Intronic
956985956 3:74701008-74701030 TTACTTTTATTCATGCAAATAGG + Intergenic
957162694 3:76630524-76630546 ATACGGTAATTGATATAAATAGG - Intronic
957960641 3:87246784-87246806 ATACTGTTAGTCATCAAAAGAGG + Intronic
958619106 3:96533588-96533610 TTTCTGTTATTGTTGAAAACTGG - Intergenic
959032888 3:101322535-101322557 ATACTGTTTATAAAGAAAATAGG + Intergenic
959165494 3:102772306-102772328 ATCCTGTTTTTAATGAGAATAGG + Intergenic
959731150 3:109604079-109604101 AAACTATTATTTATCAAAATGGG - Intergenic
961113468 3:124305810-124305832 ATAATTTTTTTGTTGAAAATTGG - Intronic
961799770 3:129438603-129438625 ATACTGTTATTGAAAAAAGCTGG + Intronic
962815859 3:138999169-138999191 ATTTTACTATTGATGAAAATTGG - Intergenic
963004076 3:140709866-140709888 ATAGTGTTATTAATAATAATAGG - Intergenic
963470327 3:145733051-145733073 ATACTGTATTTGATGAGAACAGG + Intergenic
965277432 3:166703818-166703840 ATACTGTTATATATGCAAGTAGG + Intergenic
965845535 3:172956844-172956866 ATATTGTTATTGATGCCAAATGG - Intronic
966369003 3:179226475-179226497 ATACTGATATTGTGGAAAGTTGG - Intronic
967249645 3:187523735-187523757 TTACAGATATTGATAAAAATTGG - Intergenic
970438354 4:16057375-16057397 ATGCTGTCACTGATGAAATTAGG - Intronic
971192668 4:24442509-24442531 AAACTGTTATTTATGAACATAGG - Intergenic
971439058 4:26660285-26660307 ATACTGTCTTTGGTGAAACTAGG + Intronic
971837983 4:31793866-31793888 ATGATTTTATTGATGATAATTGG + Intergenic
972072839 4:35043551-35043573 ATACAGTGATTCAAGAAAATAGG - Intergenic
972235160 4:37123780-37123802 ATATTATTATTGAAGAAACTAGG + Intergenic
972562894 4:40244088-40244110 ATACAGTTATTGATGAGGCTTGG + Exonic
973558781 4:52113154-52113176 ATACTGTTATACATCAAAATGGG + Intergenic
974568831 4:63616824-63616846 ATAGTGTTATTTATCAAATTAGG - Intergenic
975075742 4:70206804-70206826 ATATTGGTTTTGATAAAAATAGG + Intergenic
975624581 4:76332018-76332040 ATTCAATTATTGATGAAAATAGG + Intronic
975876229 4:78840167-78840189 TTAATGTTAGTGATGAAATTTGG + Intronic
977106711 4:92895083-92895105 ATACTGTGGTTAATGAGAATTGG + Intronic
978086004 4:104656058-104656080 GTATTGTCTTTGATGAAAATAGG - Intergenic
978496729 4:109367515-109367537 ATACTGTGAATAATGCAAATAGG + Intergenic
978874396 4:113621381-113621403 ATTCTTTTTCTGATGAAAATTGG + Intronic
980483338 4:133419211-133419233 ATGCTGTTATAGATGTAAAGAGG + Intergenic
981704040 4:147640616-147640638 ATACTGATAATGGGGAAAATAGG - Intronic
982074006 4:151720575-151720597 ATACTATTATTGATATAGATAGG + Intronic
982141323 4:152322291-152322313 ATACTGTGATTGATTGACATTGG + Exonic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
983921453 4:173349968-173349990 ATATTGTCATTGGAGAAAATGGG + Intergenic
985117060 4:186602859-186602881 ATACTTTTATTTTTAAAAATCGG - Intronic
985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG + Intergenic
987437287 5:17910518-17910540 ATCATGTAATTGAAGAAAATTGG - Intergenic
987588199 5:19886987-19887009 ATACTGTTATTGATGTATATTGG + Intronic
987971392 5:24949682-24949704 ACACTGTAAATGATGAAAAAGGG - Intergenic
988016386 5:25565156-25565178 ATATTGCAATTGAAGAAAATTGG - Intergenic
988129409 5:27083026-27083048 ATTCTGTTAGTCATGAAACTAGG - Intronic
990654155 5:57935860-57935882 ATAATGTTATTGATAAAGGTGGG - Intergenic
990684216 5:58282311-58282333 ACCCTGTTGTTCATGAAAATAGG + Intergenic
991035960 5:62127717-62127739 ATACTCTAATTGTTGAAAAAAGG + Intergenic
992242381 5:74785437-74785459 GTACTTTTATTGTAGAAAATTGG - Intronic
992699171 5:79323285-79323307 ATACGTTTATTGATGAGACTAGG + Exonic
992789463 5:80200722-80200744 ATATTCTTATTCATTAAAATAGG - Intronic
992825438 5:80545514-80545536 ATTCTCTTACTGATGAAAATTGG - Intergenic
993010122 5:82471427-82471449 ATGATGTTAATGATTAAAATAGG - Intergenic
993831663 5:92767605-92767627 ATACATTTATTTATGAAAAAAGG - Intergenic
994121118 5:96114048-96114070 ATACACTTATTGTTGAAAAATGG - Intergenic
994263282 5:97684934-97684956 ATACAGTTATGGATGTTAATTGG + Intergenic
995452655 5:112319655-112319677 ATACTATTTTTGAAGAGAATAGG - Intronic
995605652 5:113852045-113852067 CTACTGTTATATATCAAAATAGG + Intergenic
995726354 5:115184784-115184806 AAACATTTATTTATGAAAATAGG + Intergenic
996208974 5:120781371-120781393 ATGCTACTTTTGATGAAAATGGG + Intergenic
997077362 5:130695274-130695296 AGAATGTGATTGATGAAAATTGG + Intergenic
999955105 5:156692112-156692134 ATACTGTTATTTCAGGAAATTGG - Intronic
1000172377 5:158714783-158714805 ATACTGCCAGTAATGAAAATTGG - Intronic
1000581841 5:163044353-163044375 ATAATGTTATAAATGAAAATGGG + Intergenic
1000818218 5:165950770-165950792 ATACTGTTAGTGAATAAAGTGGG - Intergenic
1002653376 5:180721482-180721504 ATTCTGCTGTTGATGAACATTGG - Intergenic
1003000724 6:2330108-2330130 AAACTGCTGGTGATGAAAATGGG - Intergenic
1003075425 6:2979814-2979836 TTACTATTGTTGATGAAAAGAGG - Intergenic
1003299467 6:4864357-4864379 ATACTGATTTTGATAAAATTGGG + Intronic
1004399591 6:15276082-15276104 ATAATGTTAATGAGGAAAAGAGG + Intronic
1005297968 6:24445409-24445431 AGAATGTTATTAATGAAAAAAGG + Intronic
1006612807 6:35304946-35304968 ATAATGTTAATGAAGAAATTCGG + Intronic
1006708216 6:36040654-36040676 ACACAATTATTCATGAAAATTGG - Intronic
1007361112 6:41356572-41356594 ACACTGTTCTTGATGAAGAAGGG + Intergenic
1007953457 6:45894482-45894504 ATAAAGTTATAGATGAAAAAGGG + Intergenic
1008176403 6:48272816-48272838 ACACTGATACTTATGAAAATAGG + Intergenic
1008208915 6:48697017-48697039 AAACTGAAATTAATGAAAATAGG + Intergenic
1008496878 6:52143145-52143167 ATACTGTTTCTTAGGAAAATAGG - Intergenic
1009842255 6:69092643-69092665 TTACAGTTAGTGATGAAAACAGG + Intronic
1011688400 6:89843068-89843090 ATACTGTGATTTAGAAAAATAGG + Intronic
1012171828 6:96025750-96025772 ATAATGTTAGTGATGAGGATGGG - Intronic
1012200025 6:96394340-96394362 GTAATGTTACTAATGAAAATTGG + Intergenic
1012244103 6:96907001-96907023 ATTATCTTTTTGATGAAAATGGG - Intergenic
1012359561 6:98360479-98360501 TCACTGTTATTTCTGAAAATCGG + Intergenic
1012411103 6:98958066-98958088 ATACTGTTATTGTCAAAAAATGG - Intergenic
1012739137 6:102992183-102992205 ATACTTTTAGTTCTGAAAATTGG - Intergenic
1012747612 6:103114143-103114165 TTACTGTTATAGAAGAATATAGG - Intergenic
1014032473 6:116721203-116721225 ATACTGATATTCTTTAAAATAGG + Intronic
1014165134 6:118215661-118215683 ATACTTTTATTAATGTAAAATGG + Intronic
1014215331 6:118747335-118747357 ATACTGTAAATGCAGAAAATTGG - Intergenic
1014382238 6:120756740-120756762 ATTGTGTTATTAGTGAAAATTGG - Intergenic
1014977555 6:127907496-127907518 AAACTGTGATTGATCAAACTTGG + Intronic
1015483223 6:133739325-133739347 CTACTATTATTATTGAAAATTGG + Intergenic
1016594152 6:145780469-145780491 CTACTCTTATTCATGAACATGGG + Intergenic
1018695350 6:166386718-166386740 ATTCTGTTCTTGACAAAAATTGG - Intergenic
1020411735 7:7899878-7899900 ATACTGTCCTTTATGAAACTGGG - Intronic
1020528914 7:9303503-9303525 AAAATGTTATTGAGGAAAACTGG + Intergenic
1021468505 7:20973343-20973365 ATACAGTTAGTGATACAAATGGG - Intergenic
1022358896 7:29641091-29641113 ATACTGTCATTTATGGATATTGG - Intergenic
1023104871 7:36754017-36754039 TTTCTGTTTTTGATGAAAATTGG - Intergenic
1023695659 7:42843620-42843642 ATACTGTTATTGAAGATTTTTGG - Intergenic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1024960166 7:54966068-54966090 AAACTTTTATTGTTTAAAATCGG - Intergenic
1025871255 7:65436315-65436337 ATACAGTTATTGCTGATATTTGG - Intergenic
1027288837 7:76679324-76679346 ATGCTGCTATGGATGGAAATAGG + Intergenic
1027535539 7:79395595-79395617 AAACTTTTAGAGATGAAAATGGG - Intronic
1027997230 7:85439736-85439758 AGTCTATTATTGATGAACATTGG - Intergenic
1029412766 7:100426551-100426573 ATACTGTTATTAATGCAAAAAGG - Intronic
1030074892 7:105728329-105728351 ATACTGTTATTCATGCATATTGG + Intronic
1030336419 7:108332308-108332330 AAAATGTTCTTGATGCAAATTGG + Intronic
1030502608 7:110378889-110378911 TTACTGTTTTTCATGAAAACTGG + Intergenic
1031100376 7:117472517-117472539 ATTGTGTCACTGATGAAAATAGG + Intronic
1031125486 7:117768967-117768989 ATTCTCTTGTTGATGAACATTGG + Intronic
1033865424 7:145685778-145685800 ACATTGTTAATGATGATAATTGG - Intergenic
1036599435 8:10246479-10246501 CCACTATTATTGATGAAAATGGG + Intronic
1036986720 8:13540309-13540331 ATACTGTTATGTTTAAAAATGGG + Intergenic
1037186643 8:16072097-16072119 ATGCTGTTGTTAATGTAAATTGG + Intergenic
1038442082 8:27577891-27577913 ATACTCTTGTTGATGGACATTGG + Intergenic
1038905145 8:31893141-31893163 ATACTATTATTTATCAAAATAGG - Intronic
1038920831 8:32082164-32082186 ATACTCCTATTGATGGAGATAGG - Intronic
1040034611 8:42858272-42858294 CAACTGTTATGGATGATAATGGG - Intronic
1040051093 8:43015220-43015242 ATACTATTATTGACAAATATAGG + Intronic
1040383109 8:46892164-46892186 CAACTGTTATTCATGAAAACAGG - Intergenic
1040573636 8:48631336-48631358 ATACTGCTATAGATGAACACTGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041633254 8:60112671-60112693 TTAATGTTATTTATGAAAATGGG + Intergenic
1042095768 8:65214220-65214242 ATGCTATTAATGAAGAAAATGGG + Intergenic
1042156112 8:65845807-65845829 TTGTTGTTATTGCTGAAAATTGG + Intergenic
1042954758 8:74237953-74237975 ATAATGATATTTATCAAAATAGG - Intronic
1042962393 8:74317983-74318005 ATACTGTGATTTAACAAAATAGG - Intronic
1043341124 8:79240952-79240974 ATGGTGTTATTTATGAAAATGGG + Intergenic
1044044031 8:87407389-87407411 ATGATGTTATTGATGGATATTGG + Intronic
1045207683 8:100059291-100059313 ATAATGATATTGATGTAAATGGG + Intronic
1045545524 8:103124907-103124929 ATACTGTGATTGAAGATAATGGG - Intergenic
1045617070 8:103928797-103928819 ATATTTTTATTAATGAAATTGGG + Intronic
1048060223 8:130911821-130911843 ATAATTTTATTAATAAAAATAGG + Intronic
1048555989 8:135476442-135476464 ATATTCTTATTAATAAAAATGGG - Intronic
1048642409 8:136378898-136378920 ATAATGTTAGTGCTAAAAATAGG + Intergenic
1050870733 9:10565970-10565992 ATAATGTTAAGGATGTAAATAGG - Intronic
1050882802 9:10724472-10724494 ATAGCTATATTGATGAAAATTGG - Intergenic
1050978458 9:11973930-11973952 ATAATGTTATTTATAAAAAAGGG - Intergenic
1051379945 9:16446730-16446752 AGACTGTTACTGAAGAAAAAAGG - Intronic
1053570483 9:39299992-39300014 TTATTGTTATTGTGGAAAATGGG - Intergenic
1053836433 9:42140919-42140941 TTATTGTTATTGTGGAAAATGGG - Intergenic
1054092105 9:60859001-60859023 TTATTGTTATTGTGGAAAATGGG - Intergenic
1054113518 9:61134591-61134613 TTATTGTTATTGTGGAAAATGGG - Intergenic
1054126664 9:61319020-61319042 TTATTGTTATTGTGGAAAATGGG + Intergenic
1054594179 9:67047582-67047604 TTATTGTTATTGTGGAAAATGGG + Intergenic
1054977270 9:71162463-71162485 GTACTCTTATTTAAGAAAATGGG + Intronic
1055140270 9:72869103-72869125 ATCCTTTTATTTATGTAAATAGG + Intergenic
1055789602 9:79909644-79909666 ATACAGTTTTTGATGCAAAGAGG + Intergenic
1055807572 9:80114056-80114078 TTATTGTCATTGTTGAAAATTGG + Intergenic
1057120315 9:92565981-92566003 ACAATTTTATTGTTGAAAATTGG - Intronic
1058649903 9:107165777-107165799 TTACTGATGTTGAAGAAAATTGG - Intergenic
1186060902 X:5705977-5705999 AGACTTTTATTTGTGAAAATGGG + Intergenic
1186926590 X:14339471-14339493 ATAATTTTATTTATAAAAATAGG + Intergenic
1188752967 X:33926266-33926288 TTTCTCTTATTGCTGAAAATGGG + Intergenic
1191010476 X:55752187-55752209 ATACTGTTCTAGATTAATATGGG + Intronic
1192142670 X:68659037-68659059 ATAATGTCATAGATGGAAATAGG + Intronic
1192983671 X:76373484-76373506 ATACTGAAATTGTTTAAAATAGG - Intergenic
1193437211 X:81489957-81489979 ATAGTGTTATTGATACAAAAAGG - Intergenic
1193686653 X:84584782-84584804 TTACTGTGATTAATGAAAACAGG + Intergenic
1194437078 X:93879971-93879993 ATACTGTTTCTGATGGAAATTGG - Intergenic
1194785696 X:98082002-98082024 ATGCTCTTATTGAAGTAAATAGG + Intergenic
1195309857 X:103621861-103621883 ATACATTGATTGATTAAAATTGG - Intronic
1195405424 X:104507900-104507922 ATGCTGTTACTGATGACACTAGG - Intergenic
1195478552 X:105316470-105316492 AAACAGTTATTGATGAAACCAGG + Intronic
1195642365 X:107190559-107190581 TTAGTGTTATTGATGAATATAGG - Intronic
1196161167 X:112484286-112484308 AGTCTATTATTGATGGAAATTGG + Intergenic
1196264905 X:113631496-113631518 ATACTGTTTTTGTTGGAAAGAGG - Intergenic
1196916357 X:120539616-120539638 ATACTGATGTTTATGAAAATAGG + Intronic
1197980364 X:132211740-132211762 ACACTGTTATTGTTGTTAATTGG - Intronic
1199016046 X:142817031-142817053 ATATTGGTTTTGATAAAAATTGG - Intergenic
1199425522 X:147696779-147696801 AAAATTTTATTTATGAAAATAGG + Intergenic