ID: 982478150

View in Genome Browser
Species Human (GRCh38)
Location 4:155877768-155877790
Sequence TACCCCACCCTGATGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982478150_982478152 7 Left 982478150 4:155877768-155877790 CCTGCAGCCATCAGGGTGGGGTA 0: 1
1: 0
2: 0
3: 22
4: 170
Right 982478152 4:155877798-155877820 ATTTCCTCTCCCCTCAGAAGAGG 0: 1
1: 0
2: 4
3: 50
4: 297
982478150_982478158 23 Left 982478150 4:155877768-155877790 CCTGCAGCCATCAGGGTGGGGTA 0: 1
1: 0
2: 0
3: 22
4: 170
Right 982478158 4:155877814-155877836 GAAGAGGTCTGAGGAGAAAAAGG 0: 1
1: 2
2: 10
3: 79
4: 585
982478150_982478154 14 Left 982478150 4:155877768-155877790 CCTGCAGCCATCAGGGTGGGGTA 0: 1
1: 0
2: 0
3: 22
4: 170
Right 982478154 4:155877805-155877827 CTCCCCTCAGAAGAGGTCTGAGG 0: 1
1: 0
2: 6
3: 28
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982478150 Original CRISPR TACCCCACCCTGATGGCTGC AGG (reversed) Intronic
903543946 1:24112000-24112022 TCCCCCACCCTGATTTCTGGGGG + Intronic
904317628 1:29676024-29676046 TACACCTCACGGATGGCTGCTGG + Intergenic
906191207 1:43900542-43900564 TACCCCACCCCTGGGGCTGCTGG - Intronic
906717424 1:47980459-47980481 TCCCCCACCCCCATGGCAGCTGG - Intronic
908438076 1:64126481-64126503 TATCCCACCAAGATGGCTGCAGG - Intronic
909330262 1:74400792-74400814 TACCCCAGGCTGATGTCTGGTGG + Intronic
911299726 1:96157347-96157369 TACCCCACCCCAATGGCCACAGG - Intergenic
912946433 1:114088606-114088628 TGCCACATCCTGCTGGCTGCTGG + Intergenic
920098125 1:203499837-203499859 TGACTCACCCTGAAGGCTGCAGG - Exonic
924434208 1:244024350-244024372 GATGCCACCCAGATGGCTGCAGG - Intergenic
924942419 1:248821320-248821342 TCACCCTCCCTGCTGGCTGCTGG - Intronic
1066292783 10:34029324-34029346 AAACCCATCCTGATTGCTGCAGG + Intergenic
1071384935 10:85110232-85110254 TACCCCACCCTCATCCCTGGAGG - Intergenic
1075526786 10:123193827-123193849 CTCCCCACTCTGAGGGCTGCAGG + Intergenic
1076934716 10:133559681-133559703 AACCCCACCCAAATTGCTGCAGG - Intronic
1077472961 11:2772868-2772890 CACCGCACCCAGATGGCTGGAGG + Intronic
1077543785 11:3160080-3160102 TGCCCCACCCTGGTGCCTGCTGG + Intronic
1079323064 11:19468372-19468394 TACGCCACCCTGAAGGCTCTAGG + Intronic
1080640758 11:34157125-34157147 GACCCCAGACTGATGGCTTCAGG + Intronic
1083602282 11:63956194-63956216 TGCCTCACCCTGCTGGCTCCTGG + Exonic
1084163172 11:67362001-67362023 TGCCCCACCCTGAGGGGTCCGGG - Intronic
1084564066 11:69919793-69919815 TGCCCCTCCCTGCTGGCTCCAGG + Intergenic
1088200866 11:107332561-107332583 CACCCCACCCTGAAGGATGCAGG + Intronic
1089207310 11:116774802-116774824 TGCCCCACCCTGGTGTCAGCAGG + Intergenic
1093622595 12:21310445-21310467 GCCTCCACGCTGATGGCTGCTGG + Intronic
1096087924 12:48878691-48878713 TACCTGACCCTGTGGGCTGCTGG + Intergenic
1099005614 12:77231776-77231798 TACCACACACTAATGGCTGTGGG - Intergenic
1100856842 12:98764818-98764840 GAGCCCACCCTGCTGGCTGCTGG + Intronic
1102220693 12:111192416-111192438 CACTGCACCCTGATGGCTGAGGG + Intronic
1105892308 13:24690434-24690456 GACAGCACCCTGATGTCTGCAGG - Exonic
1105947075 13:25199279-25199301 TACCCCACACTGCAGGCTGGGGG - Intergenic
1106173620 13:27309532-27309554 TGCCACACCCAGATTGCTGCTGG - Intergenic
1106571958 13:30935128-30935150 TACCCCACCCACATCCCTGCAGG + Intronic
1107902090 13:45027088-45027110 TACCCCAGATTGAAGGCTGCTGG + Intronic
1108935017 13:55872541-55872563 TACCCCAGCCTGATGTCTGGTGG - Intergenic
1111586902 13:90292948-90292970 TACCCCAGGCTGATGTCTGGTGG + Intergenic
1112441309 13:99426791-99426813 TTCCCCTCCCTGCTGGCTGGAGG - Intergenic
1113440803 13:110326622-110326644 GACCTCGCCCTGAAGGCTGCAGG - Intronic
1113876622 13:113598614-113598636 TTCCCCTGCCTGATGGCTCCAGG + Intronic
1114258902 14:21024001-21024023 GACCCCACCCCGCAGGCTGCAGG - Intronic
1118350605 14:64970945-64970967 TGCCCATCCCTGATGGCAGCAGG + Intronic
1122198942 14:100110421-100110443 TGTCCCAACGTGATGGCTGCTGG - Intronic
1124098187 15:26669005-26669027 TGCCCCTCCGTGATGGCAGCTGG + Intronic
1129525316 15:76209901-76209923 CCTCCCACCCTGAAGGCTGCTGG + Intronic
1129697701 15:77749935-77749957 ACCCCCACCCTGAGAGCTGCTGG - Intronic
1132318581 15:100908719-100908741 GTCCCCAGCATGATGGCTGCTGG - Intronic
1132712837 16:1276938-1276960 GTCCCCTCCCTGATGCCTGCGGG - Intergenic
1133175383 16:4010544-4010566 TACTACACACTGATGGGTGCAGG + Intronic
1136044931 16:27607961-27607983 TACCCAACCGTGCTGACTGCAGG - Intronic
1137238323 16:46633584-46633606 CACCCCACCCTCATCCCTGCAGG - Intergenic
1141148753 16:81550079-81550101 CACCCCACCCCTATGGCTGTAGG + Intronic
1142245729 16:88969306-88969328 CACCCCACCCTGTGGGCTCCCGG - Intronic
1142480565 17:215941-215963 GACCTCACCCACATGGCTGCCGG + Intronic
1142480574 17:215974-215996 GACCCCACCCACATGGCTGCCGG + Intronic
1142480585 17:216007-216029 GACCCCACCCACATGGCTGCCGG + Intronic
1142480596 17:216040-216062 GACCTCACCCACATGGCTGCCGG + Intronic
1142480605 17:216073-216095 GACCCCACCCACATGGCTGCCGG + Intronic
1142480616 17:216106-216128 GACCTCACCCACATGGCTGCCGG + Intronic
1142480625 17:216139-216161 GACCCCACCCACATGGCTGCCGG + Intronic
1142480636 17:216172-216194 GACCTCACCCACATGGCTGCCGG + Intronic
1142480645 17:216205-216227 GACCCCACCCACATGGCTGCCGG + Intronic
1142480656 17:216238-216260 GACCTCACCCACATGGCTGCAGG + Intronic
1143749925 17:9021041-9021063 TAACCCAGCCTGATGGCCCCCGG - Intergenic
1143925659 17:10367016-10367038 TAAACCAGCATGATGGCTGCAGG - Intronic
1146450831 17:32972675-32972697 TACCCCAGGCTGATGTCTGATGG + Intronic
1149174964 17:53858754-53858776 TACCCAACCCTGAAGGCAGTCGG - Intergenic
1150141711 17:62735665-62735687 TACCACACCCTTAAGTCTGCTGG - Intronic
1151244412 17:72783533-72783555 TACCTCAGCCAGATGGCTGGAGG + Intronic
1151653961 17:75486805-75486827 TACCCCACCCCAATTCCTGCAGG - Intronic
1152113420 17:78369972-78369994 TTCCCCACGCTGTGGGCTGCTGG + Intergenic
1153359387 18:4176409-4176431 TACACCACACGAATGGCTGCTGG - Intronic
1154329217 18:13415796-13415818 CCACCCACCCTGATGCCTGCTGG - Intronic
1156098651 18:33566379-33566401 CACCCCACCCCAATGACTGCAGG - Intergenic
1159919754 18:74216692-74216714 AACCCCACCCTACGGGCTGCTGG - Intergenic
1160862276 19:1242434-1242456 TTCCCCACGCTGTTGTCTGCAGG + Exonic
1160945881 19:1643926-1643948 TCCCCAACGCTGATGGCTGATGG - Intronic
1162315413 19:9935880-9935902 TGCCCCACACTGGGGGCTGCAGG + Intronic
1164203034 19:23034067-23034089 CACCCCACCCCAATGGCTGCAGG - Intergenic
1165078747 19:33295695-33295717 CACCCCAGCTTGATGGCTGCAGG + Intergenic
925389668 2:3486599-3486621 TCACCCACCCTCAGGGCTGCTGG + Intergenic
926498001 2:13616183-13616205 TACCCCGACCTGGTGGCGGCGGG - Intergenic
926795751 2:16617583-16617605 TACCCTACCCTCCTGGCTGCAGG - Intronic
928281248 2:29948155-29948177 TACCCCACCCAGTTGGTTGGGGG - Intergenic
934508456 2:94916574-94916596 TGCCCCTCCCTGATGCCTGTGGG + Intergenic
934917454 2:98311772-98311794 TACCCTGCCTTGATGGCTGCGGG - Intronic
934931588 2:98430065-98430087 GAGCCCACCCCAATGGCTGCAGG + Intergenic
935669568 2:105543614-105543636 TGCCCCACCTTGATGGTGGCAGG - Intergenic
936105394 2:109619578-109619600 GATCCCACTGTGATGGCTGCTGG + Intergenic
937818430 2:126279772-126279794 TACCACATCCTGATTGCTGAGGG - Intergenic
943662449 2:190573697-190573719 TAGCCTACCCTGACTGCTGCAGG + Intergenic
943953121 2:194156118-194156140 TACCCCAGACTGATGTCTGGTGG - Intergenic
946175453 2:217919594-217919616 TGCTCCACCCTGATGCCAGCTGG - Intronic
1168785325 20:534506-534528 TGCCCCACCTTGCTGGCTGGGGG + Intronic
1170713426 20:18812037-18812059 TACCTCACACTGATTGCTGCAGG + Intronic
1172330944 20:34075691-34075713 TGCCGGACCCTGATGGCTGTTGG - Intronic
1172962624 20:38809202-38809224 TTCCCCGTCCTGATGGCTACAGG - Intronic
1176088056 20:63306986-63307008 GGCTCCACCGTGATGGCTGCTGG + Intronic
1176149250 20:63581054-63581076 TCCCCCACACTGAAGCCTGCTGG + Intergenic
1178410874 21:32362796-32362818 TACCCCTCACCCATGGCTGCAGG - Intronic
1178895058 21:36551072-36551094 CTCCCCACTCTGGTGGCTGCCGG - Intronic
1179106050 21:38401703-38401725 CACCCCACTCTGTTAGCTGCAGG - Intronic
1179717980 21:43299783-43299805 TACGCCACTGTGATGGCAGCTGG + Intergenic
1180127341 21:45801367-45801389 GGCCCCTCCCTGCTGGCTGCAGG + Intronic
1180154889 21:45972957-45972979 GAGCCCACCCTGAAGGCTCCCGG - Intergenic
1181306499 22:21920165-21920187 CACCCCAACCTGCTGGCAGCAGG + Exonic
1182144966 22:27991995-27992017 CAGCCCACCAGGATGGCTGCAGG - Intronic
1182556975 22:31134407-31134429 TACCCCACCCTCAGGGCCCCAGG - Exonic
1183298169 22:37044283-37044305 AGCCCCACCCTGCTGGCTGAAGG + Intergenic
1184286000 22:43471852-43471874 GAGCCCACCCTGATGGACGCTGG - Intronic
1184491784 22:44814092-44814114 TTCCCCAACCTGATGGCTTTGGG + Intronic
1185241542 22:49750026-49750048 TACCCCACCCACAGGGCTCCAGG + Intergenic
1185347444 22:50316834-50316856 TGCCCCTCACTGATGGCTGGAGG - Intronic
950013686 3:9741682-9741704 TACCCCAGCCAGATAGCAGCAGG + Intronic
951098406 3:18658253-18658275 GAGCCCACACTGGTGGCTGCAGG - Intergenic
951269051 3:20603023-20603045 CTCCCCAGCCTGATGGCAGCAGG + Intergenic
952382422 3:32816038-32816060 GGCACCACCCAGATGGCTGCGGG + Intergenic
954114689 3:48459893-48459915 TGCCAAACCCTGGTGGCTGCAGG - Exonic
962359194 3:134723082-134723104 TACCTCATCCTTATGGCTGCTGG + Intronic
965198185 3:165625344-165625366 AACCTCCCCCTAATGGCTGCAGG - Intergenic
968079654 3:195837100-195837122 TGCTCCACCCTGATGTCAGCCGG + Intergenic
968502983 4:959797-959819 TGCCCCACCCTGAGGGCCGAGGG + Exonic
968648167 4:1750034-1750056 CCGCCCACCCTGATGTCTGCAGG - Intergenic
972989505 4:44806215-44806237 TACCCCATGCTGATAGCAGCTGG + Intergenic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
982478150 4:155877768-155877790 TACCCCACCCTGATGGCTGCAGG - Intronic
983122512 4:163904506-163904528 TAGACCTTCCTGATGGCTGCAGG - Intronic
985522909 5:387254-387276 TCCCCCACCCTGCTGCCTCCTGG + Intronic
985542007 5:491724-491746 GACCCCACCCTGATCCCGGCCGG + Intronic
985774666 5:1834514-1834536 TAATCCCCTCTGATGGCTGCAGG - Intergenic
989691660 5:44152178-44152200 CACCCCACCCCAAAGGCTGCAGG + Intergenic
996314925 5:122150928-122150950 TATCCCACCAGGATGGGTGCCGG + Intronic
998404458 5:141866263-141866285 AACCCCTCCCTCCTGGCTGCAGG - Intronic
998583897 5:143405415-143405437 TACCCTACCAAGATGGCGGCGGG - Intronic
1001226090 5:169945922-169945944 TCCCCCACACTGCTGGCTCCAGG + Intronic
1001773595 5:174312780-174312802 TTCTCTACACTGATGGCTGCAGG - Intergenic
1003188926 6:3855982-3856004 CACACTACCCTAATGGCTGCAGG + Intergenic
1006556043 6:34867733-34867755 TTCCTCCCCCTAATGGCTGCTGG - Intronic
1007426353 6:41748677-41748699 TACCCCACACTCAGGGCTCCAGG + Intronic
1007648287 6:43399526-43399548 TACCCCAGGCTGATGTCTGGTGG + Intergenic
1015867169 6:137739355-137739377 TTCCCCTCCCTGTTGCCTGCTGG + Intergenic
1018846145 6:167557964-167557986 CAGCCCACCCTGCAGGCTGCTGG - Intergenic
1019004253 6:168783208-168783230 TTTCTCACCCTGATGGCTCCAGG + Intergenic
1019224827 6:170501091-170501113 TTCCTTCCCCTGATGGCTGCAGG - Intergenic
1019224834 6:170501127-170501149 TTCCTTCCCCTGATGGCTGCAGG - Intergenic
1019224847 6:170501199-170501221 TTCCCTCTCCTGATGGCTGCAGG - Intergenic
1019224910 6:170501485-170501507 TTCCTTCCCCTGATGGCTGCAGG - Intergenic
1019224921 6:170501557-170501579 TTCCTTCCCCTGATGGCTGCAGG - Intergenic
1019225112 6:170502489-170502511 TTCCTTCCCCTGATGGCTGCAGG - Intergenic
1019225122 6:170502525-170502547 TTCCTTCCCCTGATGGCTGCAGG - Intergenic
1019225149 6:170502669-170502691 TTCCTTCCCCTGATGGCTGCAGG - Intergenic
1019225160 6:170502705-170502727 TTCCTCCCCCTGATGGCTGCAGG - Intergenic
1019225196 6:170502885-170502907 TTCCTTCCCCTGATGGCTGCAGG - Intergenic
1019225227 6:170503029-170503051 TTCCTTCCCCTGATGGCTGCAGG - Intergenic
1019225289 6:170503352-170503374 TTCCCTTCCCCGATGGCTGCAGG - Intergenic
1019225335 6:170503554-170503576 TCCCTTCCCCTGATGGCTGCAGG - Intergenic
1019225344 6:170503590-170503612 TCCCTTCCCCTGATGGCTGCAGG - Intergenic
1019225353 6:170503626-170503648 TCCCTTCCCCTGATGGCTGCAGG - Intergenic
1019225478 6:170504166-170504188 TCCCTTCCCCTGATGGCTGCAGG - Intergenic
1019366421 7:635664-635686 TCTCCCTCCATGATGGCTGCAGG + Intronic
1021494776 7:21261987-21262009 TATACCACCCTCATGGCTGGTGG + Intergenic
1022518005 7:30987964-30987986 TTCCCCACCTTCATGGCTGGAGG - Intronic
1024637588 7:51302998-51303020 TACCCCACTCACAGGGCTGCCGG + Intronic
1026775743 7:73230081-73230103 TCACCATCCCTGATGGCTGCAGG + Intergenic
1027016600 7:74783453-74783475 TCACCATCCCTGATGGCTGCAGG + Intronic
1027071428 7:75162483-75162505 TCACCATCCCTGATGGCTGCAGG - Intergenic
1028999663 7:97139672-97139694 TACCCCACACTGATAGCAGCAGG - Intronic
1034178080 7:149116072-149116094 TGTCCCACCCTGCTGGCTCCTGG + Intronic
1037777105 8:21842740-21842762 TTTCCAGCCCTGATGGCTGCTGG - Intergenic
1038410429 8:27354281-27354303 TACCCCACCCTTTTGGCTGTGGG - Intronic
1039365117 8:36921078-36921100 TACCCCAGTCTCATGGATGCTGG + Intronic
1040997238 8:53414078-53414100 CACCCCACCCCAAGGGCTGCAGG - Intergenic
1042155476 8:65841153-65841175 AACCCCACCCTGGTGGGTTCCGG - Intronic
1046483402 8:114853125-114853147 TATAACATCCTGATGGCTGCAGG + Intergenic
1049274271 8:141711853-141711875 TATCCCCGCCTGATGGCTGATGG + Intergenic
1049369003 8:142254618-142254640 TCCCCCACCATGCTGGCTGTGGG + Intronic
1049553618 8:143271808-143271830 GACCCCAGCTTCATGGCTGCAGG - Intronic
1050461995 9:5885068-5885090 TCCTCCACCCTCCTGGCTGCTGG + Intronic
1051822157 9:21181041-21181063 TTCCCCAGCCAGAGGGCTGCTGG - Intergenic
1051823390 9:21193103-21193125 TTCCCCAGCCGGAGGGCTGCTGG - Intergenic
1051827193 9:21233700-21233722 TTCCCCAGCCAGAGGGCTGCTGG - Intronic
1055358935 9:75468113-75468135 TACCCCACACACAAGGCTGCTGG - Intergenic
1059162948 9:112052179-112052201 TACCCCACCAAGAAGGCTCCAGG - Intronic
1059545219 9:115169055-115169077 CACCCCACCCTGAGGGATCCAGG + Intronic
1060271399 9:122144746-122144768 TAACCCATCCTGAAGGCTGGGGG + Intronic
1060755396 9:126208642-126208664 TACCCCACGCTAATGGCAGCAGG + Intergenic
1188765641 X:34088172-34088194 ACCACCACCCTGATGGCTCCAGG + Intergenic
1189649838 X:43177421-43177443 ACCCCCACCCCAATGGCTGCAGG + Intergenic
1191753679 X:64571073-64571095 TATCCCACTCTGCTGGCTGCTGG - Intergenic
1192153159 X:68724381-68724403 TTCCCCACCCTGCAGGCAGCGGG + Exonic
1192396833 X:70790590-70790612 AACACGACCCTGATGACTGCTGG + Intronic
1194810279 X:98380351-98380373 CACCCCACCCCAATGGCTGCAGG - Intergenic
1199983830 X:152936500-152936522 TAACCTTACCTGATGGCTGCTGG - Exonic
1200136998 X:153880032-153880054 AACCCCTCCCTGTAGGCTGCTGG - Intronic