ID: 982480758

View in Genome Browser
Species Human (GRCh38)
Location 4:155907113-155907135
Sequence CAATTGCCACAAAGTTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982480756_982480758 27 Left 982480756 4:155907063-155907085 CCTTGGACTCATGGAAATTCTGA 0: 1
1: 0
2: 1
3: 23
4: 263
Right 982480758 4:155907113-155907135 CAATTGCCACAAAGTTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982480758 Original CRISPR CAATTGCCACAAAGTTCCCC CGG Intronic
900237174 1:1598422-1598444 CCGTTGCCACCAAGGTCCCCTGG + Exonic
900846189 1:5103324-5103346 TAATTGACTCAAAGTTCCACAGG - Intergenic
901174964 1:7292406-7292428 CAATTCCCATAAAGATCCACAGG - Intronic
901471318 1:9458494-9458516 CAGTTGCCATAATGTTCTCCAGG + Intergenic
902096079 1:13947141-13947163 TAATTGACACACAGTTCCTCAGG + Intergenic
902268634 1:15287377-15287399 TAATTGACTCACAGTTCCCCAGG + Intronic
903296061 1:22343727-22343749 CAATGGCCATCAAGGTCCCCTGG - Intergenic
905018568 1:34793420-34793442 CACAGGCCACAAAGTTCCCAAGG - Intronic
906045982 1:42831136-42831158 CAATTGCCACAAATGACCCTGGG - Intronic
908395896 1:63725413-63725435 TAATTGGCACACAGTTCCGCAGG + Intergenic
908603396 1:65765759-65765781 TAATTGACTCACAGTTCCCCAGG + Intergenic
909424251 1:75503539-75503561 TAATTGACACATAGTTCCACAGG - Intronic
910142227 1:84038433-84038455 TAATTGTTACAAAGTTCACCTGG + Intergenic
911273871 1:95837829-95837851 CAATTGGCTCACAGTTCCTCAGG + Intergenic
911360858 1:96873897-96873919 AAATTGCCACAGGGTTGCCCAGG + Intergenic
917211502 1:172636518-172636540 CAAATGGCACGAACTTCCCCTGG + Intergenic
917512044 1:175676787-175676809 CAAATGCCACAAAGAACCACGGG + Intronic
920548775 1:206840510-206840532 CACTTGCCACAAAGTCTCACAGG - Intronic
921639809 1:217539418-217539440 CAATGTCCACATTGTTCCCCTGG + Intronic
923769151 1:236922164-236922186 TAATTGACTCACAGTTCCCCAGG - Intergenic
1065563067 10:26982874-26982896 CTTCTGCCACCAAGTTCCCCAGG + Intergenic
1066262000 10:33738252-33738274 CACCTGCCACATAGTTCCACTGG + Intergenic
1069238738 10:66111330-66111352 TAATTGGCACACAGTTCCACAGG - Intronic
1074689588 10:115992190-115992212 TAATTGCCTCACAGTTCCACAGG - Intergenic
1076210929 10:128644281-128644303 CAATTGACTCACAGTTCCACAGG - Intergenic
1079192075 11:18287053-18287075 CATTTGCCACAATGTTGCCCAGG - Intronic
1079202332 11:18386632-18386654 CAACTGCCACAATGTTACCCAGG + Intergenic
1081123224 11:39291629-39291651 AAATTGACTCAAAGTTCCACAGG - Intergenic
1081596492 11:44463009-44463031 CAATTGACTCACAGTTCCACAGG + Intergenic
1081720007 11:45281773-45281795 CAAATGCCAGAGAGGTCCCCTGG - Intronic
1082711896 11:56562247-56562269 TAATTGACACACAGTTCCACAGG - Intergenic
1083887391 11:65579490-65579512 CAATTGCAACACAGGTCTCCTGG + Intronic
1085328499 11:75627228-75627250 CAAATGGCACAGAGTTCCCTGGG - Intronic
1085861988 11:80245258-80245280 CAATTGACTCACAGTTCCACAGG - Intergenic
1087463884 11:98479673-98479695 CAATTCCAACAAAGTTCCTGGGG - Intergenic
1088239455 11:107758645-107758667 AAATTGTTACAAAGTTCACCTGG - Intergenic
1088519173 11:110676350-110676372 TAATTGCCTCACAGTTCCTCAGG + Intronic
1088772321 11:113047672-113047694 TAATTGGCTCACAGTTCCCCAGG + Intronic
1089218807 11:116853514-116853536 AGGTTGCCCCAAAGTTCCCCGGG - Intronic
1090193797 11:124798663-124798685 AAATTGCACCAAAGTTCTCCAGG - Intronic
1090278225 11:125434396-125434418 CAATTGAAACAAAGTTCAACAGG - Intergenic
1091166553 11:133481358-133481380 CAATGGCCACACAGCTTCCCAGG + Intronic
1095833750 12:46615122-46615144 CAAATGGCACAAACTTCCCAAGG - Intergenic
1097522477 12:60686615-60686637 TAATTGACTCATAGTTCCCCAGG - Intergenic
1099525137 12:83710082-83710104 TAATTGACTCACAGTTCCCCAGG + Intergenic
1099812171 12:87597107-87597129 CAAATGGCACAAACTTCCCAAGG - Intergenic
1100203668 12:92325786-92325808 AAATTGTCACAAAGTTCAGCTGG + Intergenic
1100669575 12:96795827-96795849 AAATTGCTACAAAGTTCAGCTGG + Intronic
1100758166 12:97775140-97775162 CAAGAGCCAAAAAGTCCCCCAGG + Intergenic
1101122049 12:101592453-101592475 TTATTACCAAAAAGTTCCCCAGG + Intronic
1101290320 12:103361479-103361501 GAATTGCTACAAAGTTCAGCTGG - Intronic
1102869554 12:116402839-116402861 TAATTGACTCAGAGTTCCCCAGG - Intergenic
1102932574 12:116874003-116874025 CGATGTCCACAATGTTCCCCTGG + Intronic
1104584822 12:130039551-130039573 TAATTGACTCACAGTTCCCCAGG + Intergenic
1105569305 13:21586063-21586085 CAATTGCCACAAACTTCTAATGG - Intronic
1107729888 13:43338369-43338391 CATTTGCCAGAAACTTCCCCAGG - Intronic
1108277388 13:48825390-48825412 CAATTGGCTCACAGTTCCACAGG + Intergenic
1109896809 13:68703323-68703345 CAATTCCAACAAAATTCCCGTGG + Intergenic
1110183430 13:72644537-72644559 CAATTGCCACAAAGATAAACTGG + Intergenic
1112257862 13:97851189-97851211 CAATTGACTCACAGTTCCACAGG + Intergenic
1113391857 13:109905351-109905373 CAATTGGCTCACAGTTCCACAGG - Intergenic
1114896341 14:26995240-26995262 CAAATGCCACCAAGTTACCATGG - Intergenic
1115097152 14:29650427-29650449 CCATTGGCACCAAGTTTCCCAGG + Intronic
1115885073 14:37962166-37962188 CAATTGACTCACAGTTCCACAGG + Intronic
1115996848 14:39203813-39203835 AAATTGTCACAAAGTTCAGCTGG - Intergenic
1117594693 14:57314519-57314541 TAATTGGCTCAGAGTTCCCCAGG + Intergenic
1118487369 14:66226596-66226618 CAATTGACTCACAGTTCCACAGG + Intergenic
1119745983 14:77044277-77044299 CAACTGCCACCAAGCTCTCCTGG - Intergenic
1121571466 14:94949744-94949766 CAATGGCCACAACATGCCCCTGG + Intergenic
1121813127 14:96908896-96908918 CAATTGACTCACAGTTCCACAGG + Intronic
1124828910 15:33128604-33128626 CACTTGCCGCAAAGGTCCGCGGG - Intronic
1124938909 15:34199745-34199767 CACTTGCCACGAAGGTCCTCCGG - Intronic
1125454323 15:39842164-39842186 TAATTGGCACACAGTTCCACAGG + Intronic
1126045167 15:44633048-44633070 AAATTTCCACAAAGTTGTCCAGG + Intronic
1126870301 15:52980136-52980158 CAATTCCCAGAATCTTCCCCTGG - Intergenic
1127951862 15:63815797-63815819 TAATTGCCTCACAGTTCCACAGG + Intronic
1129382884 15:75178806-75178828 CAATTGCAACAAAGTCCCAGGGG - Intergenic
1138367015 16:56488447-56488469 CAAATGCCATTAAGTTTCCCTGG - Intronic
1138842807 16:60529339-60529361 TAATTGACTCAAAGTTCCGCAGG - Intergenic
1139362587 16:66409975-66409997 TAATTGCCTCACAGTTCCGCAGG - Intergenic
1140627363 16:76810486-76810508 TAATTGACTCACAGTTCCCCAGG + Intergenic
1146299131 17:31674506-31674528 CAATAGCCAGAAACTTCCCGAGG - Intergenic
1147675268 17:42201004-42201026 GAATTGCCACTCAGTTCCTCTGG - Exonic
1148628724 17:49090474-49090496 TAATTGGCTCACAGTTCCCCAGG + Intergenic
1156462998 18:37332179-37332201 GAATTGGCCCAAATTTCCCCAGG + Intronic
1156670164 18:39459088-39459110 TAATTGACTCACAGTTCCCCAGG - Intergenic
1158664763 18:59422511-59422533 CAATTGCAACAAGTTTCCTCAGG + Intergenic
1158968234 18:62642499-62642521 CAAATGGCACAAACTTCCCAAGG + Intergenic
1164584525 19:29458451-29458473 TAATTGGCACAAAGTTCTGCAGG - Intergenic
1167053412 19:47094205-47094227 TCATTGCCACTAAGTGCCCCAGG - Intronic
927469510 2:23362534-23362556 GAAGAGCCACAAAGTTGCCCAGG + Intergenic
930481672 2:51955320-51955342 CACTTGCCATCCAGTTCCCCAGG - Intergenic
934882138 2:97993252-97993274 CAATAGACACAAAATTCCTCCGG + Intronic
937178897 2:119971113-119971135 TAATTGACTCACAGTTCCCCAGG + Intronic
937500563 2:122474150-122474172 TAATTGCCAATAAGTTCCACTGG + Intergenic
937801170 2:126081869-126081891 TAAGTGGCACAAAGTTCCCCTGG + Intergenic
938722250 2:134077020-134077042 CAATTGACTCACAGTTCCACAGG - Intergenic
940466237 2:154030862-154030884 TAATTGACACACAGTTCCACAGG - Intronic
940480233 2:154219683-154219705 CCATTCCCAAAAAGTACCCCTGG - Intronic
940709455 2:157144352-157144374 AAATTGTTACAAAGTTCACCTGG + Intergenic
940760137 2:157729524-157729546 CACTTTCCAAACAGTTCCCCTGG - Intergenic
943691159 2:190871120-190871142 TAATTGACTCACAGTTCCCCAGG + Intergenic
944388252 2:199188588-199188610 CAACTGCAACAAAGTACCACAGG + Intergenic
946937580 2:224737570-224737592 TAATTGACTCAAAGTTCCTCAGG - Intergenic
947140141 2:227013051-227013073 CAATTGCTGCCAAGTCCCCCAGG - Intronic
1170124646 20:12949895-12949917 CAATTTCCAAAAATTTCTCCTGG - Intergenic
1177258746 21:18700773-18700795 TAATTGACTCAAAGTTCCACAGG - Intergenic
1177476495 21:21630788-21630810 CAATTGCAACAAATATACCCCGG + Intergenic
951083614 3:18483077-18483099 CAACTGCCAAAGAGTTCCACAGG - Intergenic
953892468 3:46762849-46762871 CAAGAGCTACAAAGTTCTCCAGG + Intronic
955109096 3:55929904-55929926 TAATTGCCTCACAGTTCCACAGG - Intronic
957313204 3:78545328-78545350 CCATTGCTTCCAAGTTCCCCTGG - Intergenic
957909397 3:86602778-86602800 CAATTGACTCACAGTTCCTCAGG - Intergenic
962169906 3:133090103-133090125 CACTGGCCACAAAGTTTCCAGGG - Intronic
965224886 3:165975389-165975411 CAAATGGCACAAACTTCCCAAGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
970149006 4:13069377-13069399 CTTTTGCCACAAAGTCCCACTGG + Intergenic
971866486 4:32178446-32178468 AAATTCCCAGAAAGTTCCCCTGG - Intergenic
972045499 4:34660763-34660785 CAATTAACATAAACTTCCCCAGG + Intergenic
972136965 4:35904407-35904429 CTTTTGCCACCATGTTCCCCAGG - Intergenic
973337653 4:48972538-48972560 CAATATGGACAAAGTTCCCCAGG + Intergenic
973585207 4:52383804-52383826 TAATTGACTCATAGTTCCCCAGG + Intergenic
973747182 4:53975245-53975267 TAATTGACTCACAGTTCCCCAGG - Intronic
974600350 4:64071539-64071561 CAATTGACTCACAGTTCCACTGG - Intergenic
975507983 4:75160571-75160593 CAATTCCCAGAAAATTCCACCGG + Intergenic
975978921 4:80133033-80133055 CAATTTCCACAAAGTAGCCTGGG + Intergenic
980053478 4:128060039-128060061 TAATTGCAACAAGGTTCGCCAGG + Intergenic
981709128 4:147691661-147691683 TAATTGACACACAGTTCCACAGG + Intergenic
982480758 4:155907113-155907135 CAATTGCCACAAAGTTCCCCCGG + Intronic
982948521 4:161658910-161658932 CAATTGCTACTAAGTTACCCTGG + Intronic
983583562 4:169333099-169333121 CATTCTCAACAAAGTTCCCCAGG - Intergenic
984554096 4:181193477-181193499 CAATTGCCCTGAAGTTGCCCAGG - Intergenic
987049272 5:14135871-14135893 TAATTGACTCAAAGTTCCACAGG - Intergenic
987699780 5:21382427-21382449 TAATTGCCTCACAGTTCCACAGG + Intergenic
988752623 5:34205627-34205649 TAATTGCCTCACAGTTCCACAGG - Intergenic
988953992 5:36295480-36295502 TAATTGACACACAGTTCCACAGG - Intronic
989308925 5:39990235-39990257 GAATTTTCACAAAGTTCCCCTGG - Intergenic
989691605 5:44151792-44151814 CAAATGGCACAAACTTCCCCTGG - Intergenic
990124717 5:52499919-52499941 TAATTGGCACACAGTTCCACAGG - Intergenic
992479262 5:77134375-77134397 CAAGAAGCACAAAGTTCCCCAGG - Intergenic
993809855 5:92463159-92463181 TAATTGACTCAAAGTTCCTCAGG + Intergenic
993865615 5:93191080-93191102 CAACTGCCACAAGGTGACCCTGG - Intergenic
994106609 5:95956671-95956693 CAAATGCTAAAAAGTTCACCTGG + Intronic
994144893 5:96383826-96383848 CTATTGCAACAGAGTGCCCCTGG - Intergenic
994210870 5:97085885-97085907 TAATTGCCTCACAGTTCCGCAGG + Intergenic
994579015 5:101614769-101614791 CTTTTGCCACCATGTTCCCCAGG - Intergenic
995477474 5:112562632-112562654 TAATTGGCTCAAAGTTCCTCAGG - Intergenic
995532053 5:113101637-113101659 CAAATGCCACAAAATTCTCACGG + Intronic
996653245 5:125908184-125908206 CATTTTCAACAAAGTTGCCCAGG - Intergenic
997787838 5:136729667-136729689 CAAAAGCCACAAAGTTAGCCAGG + Intergenic
1001473513 5:172032829-172032851 TAATTGCCTCACAGTTCCACGGG + Intergenic
1003536406 6:6979370-6979392 CAATTGTCACTATGTTGCCCAGG - Intergenic
1003895882 6:10607225-10607247 TAATTGCCTCACAGTTCCACAGG + Intronic
1004774144 6:18823405-18823427 CAATTGGCTCATAGTTCCACAGG - Intergenic
1005550787 6:26912347-26912369 TAATTGCCTCACAGTTCCACAGG - Intergenic
1009567899 6:65336114-65336136 TAATTGTCACACAGTTCCACAGG - Intronic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1013823319 6:114181249-114181271 TGATTGTCACAATGTTCCCCGGG - Intronic
1014281250 6:119444533-119444555 CAATTGGCTCACAGTTCCACAGG - Intergenic
1014351332 6:120349920-120349942 TAATTGCCTCACAGTTCCACAGG + Intergenic
1017361627 6:153579399-153579421 CAAATGGCACAAACTTCCCGAGG - Intergenic
1018227126 6:161639158-161639180 TAATTGACTCAAAGTTCCACAGG - Intronic
1020520656 7:9182116-9182138 CAATTCCCCCAAACTGCCCCTGG + Intergenic
1020546510 7:9540009-9540031 CAATTGAAACACAGTTCCTCAGG - Intergenic
1021336197 7:19405549-19405571 CAATTGCCACAAAATTGCCATGG + Intergenic
1021674311 7:23064860-23064882 TAATTGACTCAAAGTTCCACAGG - Intergenic
1022164644 7:27745387-27745409 TAATTCCCACATAGTTCCTCTGG - Intronic
1022890139 7:34688747-34688769 CTACTGCCACAAAGTTTTCCTGG - Intronic
1022899722 7:34793931-34793953 CACTTGACACAATGTTCTCCAGG - Intronic
1023321709 7:39005321-39005343 CACATGCCACAATGTTCCCGTGG - Intronic
1025772727 7:64528257-64528279 AAATTGTCACAAAGTTCAGCTGG - Intronic
1026034308 7:66820072-66820094 TAAATGCCACCAAGTTGCCCTGG - Intergenic
1027279101 7:76592746-76592768 TAATTGCCTCAGAGTTCCACAGG + Intergenic
1028914037 7:96238767-96238789 AAACTGCCAGCAAGTTCCCCTGG - Intronic
1032354181 7:131194275-131194297 CAATTGCTTCCAACTTCCCCCGG + Intronic
1033952542 7:146802705-146802727 TAATTGACTCACAGTTCCCCAGG - Intronic
1037105734 8:15105379-15105401 TAATTGACTCAAAGTTCCACAGG + Intronic
1040635744 8:49270825-49270847 AAATTGTCACAAAGTTCAGCTGG + Intergenic
1041334362 8:56763377-56763399 TAATTGGCTCATAGTTCCCCAGG - Intergenic
1043415109 8:80039853-80039875 CAAGTGGCAGAAAGTTCACCTGG - Intronic
1044497926 8:92913237-92913259 CATTTAACACAAAGTTCACCAGG + Intronic
1044737713 8:95296305-95296327 CAATAACCACAAAGTAACCCTGG - Intergenic
1049869837 8:144966002-144966024 GAATTGCTACAAAGTTCAGCTGG + Intergenic
1050615759 9:7400341-7400363 TAATTGACTCACAGTTCCCCAGG + Intergenic
1053898199 9:42765693-42765715 TAATTGACTCAAAGTTCCACAGG - Intergenic
1056002546 9:82232256-82232278 TAATTGACACATAGTTCCACAGG + Intergenic
1056118987 9:83468717-83468739 TAATTGCCATAAAGTTTCCACGG - Intronic
1057350059 9:94288798-94288820 CAATTGACTCACAGTTCCACAGG - Intronic
1057736661 9:97668601-97668623 CAAGTGCCACTAAATTTCCCTGG + Intronic
1060702834 9:125774060-125774082 TAATTGGCACACAGTTCCACAGG + Intronic
1186047982 X:5556833-5556855 TAATTGACTCACAGTTCCCCAGG - Intergenic
1186131808 X:6475268-6475290 CAATTTCCAGAAAATCCCCCGGG + Intergenic
1187581531 X:20612471-20612493 ACAATCCCACAAAGTTCCCCAGG - Intergenic
1188178031 X:27018495-27018517 CTAGGGCCTCAAAGTTCCCCAGG + Intergenic
1188579937 X:31699385-31699407 CAATAGCCATACTGTTCCCCTGG + Intronic
1189216889 X:39333050-39333072 TAATTGCCACAAGGTTCCTATGG - Intergenic
1189616410 X:42788947-42788969 CAAATGGCACAAACTTCCCGAGG + Intergenic
1190795742 X:53739608-53739630 CCATAACCACAAAGATCCCCTGG + Intergenic
1191770143 X:64746908-64746930 TAATTGGCCCAAAGTTCCACAGG + Intergenic
1193143694 X:78055768-78055790 TAATTGACTCAAAGTTCCACAGG + Intergenic
1194253394 X:91605108-91605130 CAATTGACTCACAGTTCCACAGG - Intergenic
1194515906 X:94854267-94854289 CAATTGTAACAAAGTTCAGCTGG - Intergenic
1195018172 X:100798868-100798890 CTTCTGCCACCAAGTTCCCCAGG - Intergenic
1195613336 X:106893752-106893774 TAATTGACTCACAGTTCCCCAGG + Intronic
1196160149 X:112474197-112474219 TAACTGCCACATAGTTCCTCAGG + Intergenic
1198080518 X:133235336-133235358 CAATACCCACAATGTTCTCCTGG + Intergenic
1198870291 X:141171730-141171752 TAATTGCCTCATGGTTCCCCAGG - Intergenic
1200415731 Y:2907865-2907887 CAATAGCCAAAAAGTTTGCCAGG - Intronic
1200572171 Y:4844701-4844723 CAATTGACTCACAGTTCCACAGG - Intergenic
1200839601 Y:7767577-7767599 CAATTTCAACAAAGTTTACCAGG + Intergenic
1201161389 Y:11169313-11169335 CAGTGGCCACAGAGTTCACCCGG + Intergenic