ID: 982482382

View in Genome Browser
Species Human (GRCh38)
Location 4:155928149-155928171
Sequence TAGTATTTGAAAAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 631}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982482382_982482386 26 Left 982482382 4:155928149-155928171 CCCTCTTCCTTTTTCAAATACTA 0: 1
1: 0
2: 7
3: 64
4: 631
Right 982482386 4:155928198-155928220 ACACTTTTTTTTTTATCATTTGG 0: 1
1: 0
2: 11
3: 175
4: 1768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982482382 Original CRISPR TAGTATTTGAAAAAGGAAGA GGG (reversed) Intronic
900836989 1:5012617-5012639 TTGTATTTGCATAAGGAAGGGGG + Intergenic
900846251 1:5104060-5104082 TAGGATTTAAAAAAAAAAGATGG - Intergenic
902681466 1:18046835-18046857 TAGTTGATGAAAAAGTAAGAAGG + Intergenic
904786406 1:32986394-32986416 AAGAATTTGAAGATGGAAGAGGG + Intergenic
905716779 1:40159163-40159185 TAGTATAGGAAATAGGAAAATGG - Intergenic
906028961 1:42701414-42701436 CATTATTTCAAAAAGGAAGTGGG + Intronic
907719909 1:56962025-56962047 TTGTAGTTGAAATAGGAAGAGGG - Intronic
907893572 1:58661435-58661457 TAGTATTTGAAAAGACAAGATGG - Exonic
908138964 1:61162840-61162862 TAGTGTTTGCAAATGGAAAATGG + Intronic
908492743 1:64662901-64662923 TACTATTTAAGAAAGAAAGATGG - Intronic
908652480 1:66351050-66351072 TATTTTTTGAAAAGGGAAGAAGG - Intronic
908963176 1:69726729-69726751 TAAAATTTGAAAATGTAAGAGGG + Intronic
910020396 1:82582268-82582290 TAGCATTAGTAAAATGAAGAGGG + Intergenic
910044311 1:82893089-82893111 TATTATTTGAAAAGTAAAGATGG - Intergenic
910052456 1:82991578-82991600 TAGTCCTTGTAAAAGGGAGATGG - Intergenic
910133623 1:83939826-83939848 AAAAATTTGAAATAGGAAGAAGG + Intronic
910139362 1:84009705-84009727 TATGATCTGAAAAAGGAACATGG + Intergenic
910592222 1:88938332-88938354 TACAATTTTAAAAAGAAAGATGG - Intronic
910885093 1:91955670-91955692 AAGTAATTGAAACAGTAAGATGG + Intronic
910980034 1:92951018-92951040 TAGTATTTGAAATAACCAGAGGG - Intronic
911041597 1:93595289-93595311 TTGTATTTTAAAAGGGAAGGAGG + Intronic
911618675 1:100042009-100042031 TAGTATTTGAAAATGTCAGAAGG - Intronic
912145115 1:106784096-106784118 TAGTAATGAAAAAAGGAAGCTGG + Intergenic
912197769 1:107419609-107419631 TTTTTTTTGAAGAAGGAAGAAGG - Intronic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
913682985 1:121204604-121204626 AATTATTAGAAAAAGCAAGATGG - Intronic
914034827 1:143992230-143992252 AATTATTAGAAAAAGCAAGATGG - Intergenic
914154627 1:145075739-145075761 AATTATTAGAAAAAGCAAGATGG + Intronic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916676413 1:167067401-167067423 TACTTTTTTAAAAAAGAAGAAGG - Intronic
916821700 1:168404986-168405008 TAGTTTGGGGAAAAGGAAGAAGG - Intergenic
917034060 1:170726846-170726868 TTGAATTAAAAAAAGGAAGAAGG + Intronic
917605096 1:176619728-176619750 AAGTATATGAAAAAGAAAAATGG - Intronic
917852521 1:179077650-179077672 TAGAGTTTGAAAAAGGTAGCTGG + Intergenic
918065763 1:181100605-181100627 AAGTGTTTGAAGAACGAAGATGG - Intergenic
919005390 1:191892357-191892379 TAGTAAATGTAATAGGAAGATGG + Intergenic
919118336 1:193309121-193309143 AAATATTTGAAAAAGAAAAAAGG + Intergenic
919211680 1:194495205-194495227 TTGTATTTTAAAATGGGAGAAGG - Intergenic
919261684 1:195203663-195203685 CAGTATTTCAAATATGAAGATGG + Intergenic
919360872 1:196592764-196592786 TAGTATTTGATAACACAAGAGGG + Intronic
919563950 1:199160550-199160572 TATTATGTGAAAGAGAAAGAGGG - Intergenic
919581313 1:199377591-199377613 TTCTATTTGAAAAATGAAGCTGG - Intergenic
919658761 1:200222755-200222777 TAGAATGGGAAAAAGGAATATGG - Intergenic
919966155 1:202527476-202527498 TAGTATTTGGAAGAGAAATAGGG + Intronic
920470296 1:206223118-206223140 AATTATTAGAAAAAGCAAGATGG - Intronic
921148694 1:212382996-212383018 TCCCATTTGGAAAAGGAAGAAGG - Intronic
921640722 1:217549376-217549398 TAATATTTGGGAAATGAAGATGG + Intronic
922855016 1:228767723-228767745 TCTAAATTGAAAAAGGAAGAAGG + Intergenic
922939724 1:229451606-229451628 TAGTTTTTGGGAAAGGAAGATGG - Intronic
923206387 1:231762905-231762927 TCTTATTTTAAAAATGAAGAAGG + Intronic
923300298 1:232633953-232633975 TAGTAATAGAAAACGGAAGGAGG - Intergenic
923366187 1:233264008-233264030 TACTACTTCCAAAAGGAAGAGGG + Intronic
923488178 1:234456924-234456946 TAGTTTTTGAGAAATGAAGAAGG - Intronic
923737311 1:236622806-236622828 TAGTATTGGAAACTGGAGGAAGG + Intergenic
924584840 1:245353242-245353264 TAGTATGTGAAAGAGGGAGAGGG - Intronic
924705361 1:246496994-246497016 TACTATTTGAAAAGTGAAAATGG - Intronic
1063511282 10:6647265-6647287 TAGACTTTGAGAAAGGAAGATGG - Intergenic
1063676543 10:8145577-8145599 TTGTGTTTGTAAAAGGCAGAGGG + Intergenic
1063794379 10:9494819-9494841 TAGAACTTCAAAAAGGATGATGG - Intergenic
1064623235 10:17236081-17236103 TAGTACTTGCAGCAGGAAGAAGG - Intronic
1065038775 10:21668980-21669002 AAGTATTTGAAAAATGAGGTGGG + Intronic
1065321868 10:24517592-24517614 TAGTACTTGGAAGAAGAAGAAGG - Intronic
1066128200 10:32363048-32363070 AAGTATCTGTAACAGGAAGAGGG + Intronic
1066339167 10:34512680-34512702 TAGTTTTTAAAAAAGGAACGTGG - Intronic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1067990776 10:51209579-51209601 TAGTACTTGAAAAAGTAACATGG + Intronic
1068176599 10:53468093-53468115 AAGTATTAGGAAAACGAAGAAGG - Intergenic
1069159691 10:65078657-65078679 TAGTAATTTATAAAGGAAAAAGG - Intergenic
1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG + Intronic
1069804548 10:71111215-71111237 TATAAATTGAAAAAGAAAGAAGG - Intergenic
1070676635 10:78416220-78416242 TAGTTTCTGAAGAAGGAAGATGG - Intergenic
1070896209 10:79984436-79984458 CAGGATTTGAAGAAGGGAGAAGG + Intergenic
1071826082 10:89327593-89327615 TAGTAATTCCAAAAGGAAAAAGG + Intronic
1072337955 10:94416804-94416826 TAGTATTTTACTAAAGAAGAGGG + Intronic
1072377785 10:94835785-94835807 TAGAATTAGGAAAAGGAAAAAGG - Intronic
1072471590 10:95718638-95718660 TAGAATTAGAAGAAGGAAAAAGG - Intronic
1072567128 10:96626037-96626059 GAGTATTAGAAATAGGAGGAGGG - Intronic
1073613111 10:104964307-104964329 TAGCATTTGCAAAAGGATGTAGG - Intronic
1073991685 10:109268677-109268699 CAATATCTCAAAAAGGAAGAAGG + Intergenic
1074483085 10:113845412-113845434 AAGTATTTTAAAAAATAAGATGG + Intronic
1075143627 10:119864116-119864138 TTGTCTTTGAAAACGGAAGGGGG + Intronic
1075190342 10:120301386-120301408 TCCTATTTAAAAAAGGAAAAAGG - Intergenic
1075812737 10:125237495-125237517 TGGTATATGAAAAATGGAGAAGG - Intergenic
1077038192 11:505433-505455 TAGGTTTTGAAGATGGAAGAAGG + Intronic
1077618772 11:3700051-3700073 TAGGATTTAGAAAAGCAAGAAGG + Intronic
1077760538 11:5091411-5091433 TAGAATCAGAAAAAGGAAGTAGG - Intergenic
1078700764 11:13680141-13680163 TAATTTTTGAAAAAGGAAAAAGG + Intronic
1079010557 11:16824758-16824780 TTTTATTTGAAAAAGCAATAGGG - Intronic
1079107515 11:17581004-17581026 TAGTTTTTGAAGAAGGAACGTGG + Intronic
1079409287 11:20172068-20172090 TAGTATTTCAAGGAAGAAGAAGG - Intergenic
1079431250 11:20390437-20390459 TAGGACTTGAAAAAGGACGCAGG + Intronic
1079496894 11:21054261-21054283 TACTATTTGAAAAAGAATGTTGG - Intronic
1080180960 11:29425727-29425749 TAGTGTGAGAAAAAGTAAGAAGG - Intergenic
1080437633 11:32260897-32260919 CAGAATTTGAGAGAGGAAGAGGG + Intergenic
1081068532 11:38578584-38578606 TAGTATTTTAAAAAAGAATTTGG - Intergenic
1081447404 11:43144217-43144239 TAGTACTAGAAGAAGGAAGTGGG + Intergenic
1082712767 11:56574602-56574624 CAGTAACTGAAAAAGAAAGAAGG - Intergenic
1082715757 11:56611276-56611298 CAGTATCTGAAAAAGAAGGAAGG - Intergenic
1082718773 11:56647565-56647587 TATTAATTTAAAAAGCAAGAAGG - Intergenic
1084976284 11:72800842-72800864 TAGTATTTAAAAAAAAAACAAGG - Intergenic
1085006495 11:73096238-73096260 TTGTATTTAAAAAAGAAAGCAGG + Intronic
1085201345 11:74704043-74704065 CAGTTTTTGACAAAGGAAGGAGG - Intronic
1085370668 11:76001651-76001673 TAGTATTTTAAAAAACATGATGG + Intronic
1086197323 11:84155974-84155996 TAGTATTTGGGAAAGGATGAAGG + Intronic
1086372273 11:86166834-86166856 TTCTTTTTCAAAAAGGAAGAAGG + Intergenic
1086936674 11:92752855-92752877 TCGTATTTTAAGAAGGAAGCTGG + Intronic
1087106899 11:94418643-94418665 TAGTATTTGAACAAAGCAGAAGG - Exonic
1087115676 11:94521947-94521969 TGGAATTTGAGAAAGGAACAAGG - Intergenic
1087384940 11:97459141-97459163 GAGAATTTGATAATGGAAGAGGG - Intergenic
1087548199 11:99611674-99611696 AAGTAGTTGAAAAAGGTGGATGG + Intronic
1088087704 11:106001427-106001449 GAGTAATGAAAAAAGGAAGATGG + Intronic
1088517216 11:110650639-110650661 TAAAAATTAAAAAAGGAAGAGGG + Intronic
1091011516 11:132005638-132005660 TAGGATATGAAAATGGAAAAGGG - Intronic
1092669675 12:10848716-10848738 AAATATTTAAAGAAGGAAGAAGG - Intronic
1092835031 12:12479256-12479278 TTGCATTTGAATAAGGAACAAGG + Intronic
1093124034 12:15307013-15307035 TTCTGTTTGAAAAAAGAAGAGGG - Intronic
1093286784 12:17273505-17273527 TAATATTTGAAATAGGAGGGAGG + Intergenic
1093736033 12:22622042-22622064 TAATATTTAACAAAGGAAAAAGG - Intergenic
1094117289 12:26930860-26930882 CAGTATTTAAAAAAGTAAGGTGG + Intronic
1094505523 12:31057678-31057700 TGGTTTTTTAAAAAGGAAGAAGG - Intergenic
1094610944 12:31995171-31995193 TACTATTTAAAAAATGAAGTAGG - Intergenic
1094731903 12:33186405-33186427 TATTAATAGAAAAAGGAAGAAGG + Intergenic
1094773521 12:33694481-33694503 TACTATTGGCAAAAGGCAGAAGG - Intergenic
1095626704 12:44322995-44323017 GAGTCTTTAAAAGAGGAAGAGGG + Intronic
1095664608 12:44781971-44781993 TAGTATGTAAAAAAGAAAAATGG + Intronic
1096739443 12:53681653-53681675 TGGTTTTTTAAAAAGGAGGAGGG - Intergenic
1097269061 12:57763250-57763272 TAGGATCTGGAAAGGGAAGAAGG + Exonic
1097463184 12:59888981-59889003 TATTACTTGGAAAAGGGAGATGG + Intergenic
1097655337 12:62354539-62354561 TATTATATGCCAAAGGAAGAGGG + Intronic
1098187864 12:67916996-67917018 TAAAATTTTAAAAAGGAAAAAGG - Intergenic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098432310 12:70433435-70433457 TAGCCTGTGAAAAAAGAAGAAGG + Exonic
1098514309 12:71356544-71356566 TAGTAATTGAAAAACGAGAAAGG + Intronic
1098718918 12:73869674-73869696 TAGAAGTTGAGAAAGAAAGATGG + Intergenic
1098767734 12:74510868-74510890 TAGTTTTTCAAGCAGGAAGAAGG - Intergenic
1099237887 12:80103802-80103824 AACTATTTGAAAAAGAAAAATGG + Intergenic
1099514085 12:83574889-83574911 TAATAATTGAAAAATTAAGAGGG - Intergenic
1099673127 12:85719729-85719751 TAGTTTTTGAAAACAGAAGAAGG - Intergenic
1100502156 12:95184405-95184427 TAGAATCTGAAGAAGAAAGATGG - Intronic
1100605712 12:96150470-96150492 AATTATTTAAATAAGGAAGAGGG + Intergenic
1100655847 12:96644581-96644603 TGGTAATTTATAAAGGAAGAAGG + Intronic
1101037886 12:100722815-100722837 TATTATTTGCAATAGGAAAAAGG - Intronic
1101084491 12:101221994-101222016 TGGTATTTAACAAATGAAGAAGG - Intergenic
1102860814 12:116334931-116334953 TGGTATTTTAAAAAGCAAGCTGG - Intergenic
1103492656 12:121334769-121334791 TAGTATTTCAAAAAGCCAGAAGG - Intronic
1105309112 13:19190470-19190492 TAACATTTGAAAAGGGATGAAGG + Intergenic
1106353705 13:28958920-28958942 TAGTATTTAAAAAAACAAGCTGG + Intronic
1106572523 13:30940186-30940208 TAGTCTTGGAAGATGGAAGAAGG + Intronic
1106836090 13:33636564-33636586 CAGACTTTGAAACAGGAAGAAGG - Intergenic
1107477367 13:40751928-40751950 TTTTATTTTAAAAAGTAAGATGG + Intronic
1107588458 13:41878657-41878679 GAGTGTTTTAAAAAGGAAAAAGG - Intronic
1107647473 13:42509862-42509884 TAGTTTTTGAAAGAAGAAGGAGG - Intergenic
1107689219 13:42935167-42935189 TAGTACTTGAAAGAAGAACATGG - Intronic
1108317907 13:49255830-49255852 TTTTATTAGAAAAATGAAGAGGG + Exonic
1109367162 13:61370387-61370409 GAGTATCTGCAAAAGGCAGAAGG - Intergenic
1109700448 13:66018202-66018224 TAGGATTTGAAAAAGTCAGTAGG + Intergenic
1109819393 13:67633231-67633253 TAGTTTTTGAATCAGGAAGTGGG + Intergenic
1109973354 13:69799558-69799580 TCTAATTTGAAAAATGAAGATGG - Intronic
1110244194 13:73303313-73303335 TGGTAATTGGAATAGGAAGAAGG - Intergenic
1110354573 13:74552397-74552419 TCGTAATTGAAAAAGGAAACAGG - Intergenic
1110424891 13:75355697-75355719 TGATATTTCAAAAATGAAGAAGG + Intronic
1110428002 13:75391262-75391284 TAGTAGTTAGAAAAGGAAGTGGG - Intronic
1110779865 13:79452541-79452563 AAGTATTTGTATCAGGAAGAGGG + Intergenic
1111039310 13:82724312-82724334 TACTATTTGATAATGGAATAGGG - Intergenic
1111784818 13:92773020-92773042 TATTATCGGAAAAAGGAATATGG - Intronic
1112123124 13:96434900-96434922 TATTATTTGATCAAGAAAGAAGG - Intronic
1112297668 13:98202502-98202524 TTGTATTTAAAACTGGAAGAGGG + Intronic
1112560297 13:100506772-100506794 TAGGAGGAGAAAAAGGAAGAGGG + Intronic
1112587990 13:100736743-100736765 TGGTGTTTGGAAAAGGGAGAGGG - Intergenic
1112760478 13:102689098-102689120 TATTATTTTTAAAAGGGAGATGG + Intronic
1113224681 13:108146603-108146625 TACTTTTTTAAAAAGGAAGATGG + Intergenic
1113554267 13:111218920-111218942 AAGTATTTTAATAAGGCAGATGG + Intronic
1114142159 14:19925539-19925561 GAATATTTTAAAAAGTAAGAAGG + Intergenic
1114874480 14:26698720-26698742 TAGTTTTTAACAAAGGAAAAGGG - Intergenic
1117345246 14:54825622-54825644 TAGAATTTGAAAAAGAGAGAAGG + Intergenic
1117363547 14:55002229-55002251 TTGAATTTGAAGAAGGAAAAAGG + Intronic
1118359912 14:65047114-65047136 TTGTAGTAGAAAAAGTAAGAAGG - Intronic
1119157652 14:72425914-72425936 TAGAATATTAAAAATGAAGAAGG + Intronic
1119309660 14:73635107-73635129 AAGAATTTAAAAAAGAAAGATGG - Intergenic
1119378900 14:74216344-74216366 TTATTTTTAAAAAAGGAAGATGG - Intergenic
1120009443 14:79396800-79396822 TAGTAGTTGAAAAAGAAGTAGGG - Intronic
1120210017 14:81624668-81624690 TGGATTTTGAAAAAGGAGGAGGG - Intergenic
1120254325 14:82099226-82099248 GAGTTTTTGAAAAATGAAAAGGG - Intergenic
1120789268 14:88563800-88563822 TAAGATTTGAAGAAGGTAGAAGG - Intronic
1120846011 14:89125789-89125811 TAGTATTAGACAAATGCAGAAGG - Intronic
1121653659 14:95578791-95578813 CAATATTTAAAAAAAGAAGAAGG - Intergenic
1122299403 14:100723404-100723426 TAGTGTTTAGAAAAGGAGGAGGG + Intergenic
1122315950 14:100826244-100826266 AAGGATGTGCAAAAGGAAGACGG + Intergenic
1123014009 14:105365019-105365041 ATCTATTTGAAAATGGAAGAGGG + Intronic
1124111432 15:26793576-26793598 TATTATTTAAAAAAGAAAAAAGG - Intronic
1124229768 15:27934160-27934182 CAACATTTTAAAAAGGAAGATGG + Intronic
1125053808 15:35334119-35334141 TTGTATTTAAAAATGGAAGAGGG + Intronic
1125120493 15:36152916-36152938 AAGTATTTGAGAAGGGAACAGGG + Intergenic
1125319393 15:38468038-38468060 AAGGATCTGCAAAAGGAAGAAGG + Intronic
1125393341 15:39220195-39220217 TAGTATTGCAATAAAGAAGAGGG + Intergenic
1126689198 15:51274838-51274860 GGGTATTTGAAGAAGAAAGAAGG + Intronic
1126834853 15:52651149-52651171 TAGTATTTTAAAATTGAAGTAGG - Intronic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1127027138 15:54819419-54819441 TAGGATTTGATAAAGAAAGCTGG - Intergenic
1127108625 15:55644466-55644488 TATTTTTTTAAAAAGGAAGAAGG - Intronic
1127282917 15:57507088-57507110 TAGTGGTTGACAAAGGATGAGGG - Intronic
1128962138 15:72017467-72017489 TAGTACGTGAAAAAGGAAAAGGG + Intronic
1130138332 15:81200073-81200095 TTGTTTTAGAAAAAGGAAGTTGG - Intronic
1130362521 15:83204674-83204696 TAGAAATTCAAAAAGGAAAAAGG + Intronic
1130877978 15:88030755-88030777 TTTTTTTTTAAAAAGGAAGAAGG - Intronic
1131309639 15:91278110-91278132 CAGTATTTGAGGAAGTAAGATGG + Intronic
1131661295 15:94520593-94520615 TAGAATTTGAAAAAAGAGGAGGG - Intergenic
1131716640 15:95118540-95118562 TAGTATTTGATAAAGCAACAGGG + Intergenic
1131747535 15:95465319-95465341 AAGTAGTTGAAAAAAGATGATGG - Intergenic
1131839723 15:96424241-96424263 TAGTATTTTAAAATGGACAATGG + Intergenic
1131887407 15:96931765-96931787 TTTTATATGAAAAAGGAACATGG + Intergenic
1131915324 15:97259096-97259118 TATTTTTTAAAAAACGAAGAGGG + Intergenic
1132316103 15:100891640-100891662 TGGTGATTGAAAAAGGAAGAAGG - Intronic
1132882111 16:2167086-2167108 TAGGATTAGAAAAAAAAAGAGGG - Intronic
1133084532 16:3351610-3351632 TAGCATTTTAAAAAGGATAATGG - Intergenic
1133187694 16:4111974-4111996 TCGAATTTCAAAAATGAAGAGGG - Intronic
1133822386 16:9248217-9248239 TAGTATTTGACAAGGCCAGATGG + Intergenic
1133951309 16:10395925-10395947 TATTATTTGAAAAAAAAAAATGG - Intronic
1134076534 16:11296019-11296041 TATTAATTTAAAAAGGAATAGGG - Intronic
1135054328 16:19218483-19218505 TTGTATCTGCAAAGGGAAGAAGG + Intronic
1135823479 16:25705362-25705384 TGGTATTTTGAAAAGGAAGCTGG + Intronic
1137329431 16:47476646-47476668 TAGAATTTAAAAAACTAAGAAGG - Intronic
1137449337 16:48556324-48556346 TAGGACTTGAAGTAGGAAGAAGG - Intronic
1138039788 16:53650756-53650778 AAGTATTTGAAGAAGGAAGGAGG - Intronic
1138110571 16:54320567-54320589 TAGTTTTTAAAATAGGAAAATGG + Intergenic
1138439001 16:57023234-57023256 AAGAGTTTGAGAAAGGAAGAAGG - Intronic
1140183424 16:72744135-72744157 TATAAGTTCAAAAAGGAAGAAGG + Intergenic
1140546266 16:75812773-75812795 TAGTATTTGATAACGCAACAGGG - Intergenic
1141061195 16:80872707-80872729 CTGTATTTTAAAAAGGAAAAGGG + Intergenic
1142349532 16:89573779-89573801 TAATATTTCAACAAGGAACACGG + Intergenic
1143602127 17:7954186-7954208 TATTATTGGAAAATGAAAGATGG + Intergenic
1143607302 17:7995788-7995810 TGATATTTGAAAAAGAAAAATGG - Intergenic
1143612021 17:8023972-8023994 AAGCATGTGAAATAGGAAGAAGG - Intergenic
1144229830 17:13190809-13190831 TACTGGTTGAGAAAGGAAGAGGG + Intergenic
1144721463 17:17473392-17473414 ATGTATTTGAAAAAGGAACTGGG - Intergenic
1146277018 17:31522601-31522623 TAGGATTTGAAGAAGGGACAAGG - Intronic
1147532948 17:41297482-41297504 AATTTTTTTAAAAAGGAAGAAGG - Intergenic
1148419529 17:47533074-47533096 TTGTCTTTGAAAAACCAAGAGGG + Intronic
1148946083 17:51262530-51262552 TACTATTAGCAAAAGGGAGATGG - Intronic
1149460462 17:56825894-56825916 GAGTATTTGAAAAAGTAAAAAGG - Intronic
1150463688 17:65373529-65373551 TAGAAATTGAAAAAAGTAGATGG - Intergenic
1150594877 17:66595163-66595185 TAATTTTTTAAAAAAGAAGAAGG - Intronic
1150896733 17:69220287-69220309 CAGTATATGAAAAGGAAAGAAGG + Intronic
1152932527 17:83117202-83117224 TAGTTTTTGAAAAATAGAGATGG + Intergenic
1153004688 18:487466-487488 TAGTATGTGAAAAAAAGAGAAGG + Intronic
1154291268 18:13109533-13109555 TAAAAGTTGAAAAAGGAAAACGG + Intronic
1155283687 18:24267087-24267109 CAGTATTAGAAAAAAGAAAATGG + Intronic
1155676406 18:28434617-28434639 TAAAATTTGAAAAAGAAAAACGG - Intergenic
1155983957 18:32209996-32210018 GAGAATATGAAAAAGGAAAATGG - Intronic
1156278320 18:35606700-35606722 TCCTACTTTAAAAAGGAAGAGGG - Intronic
1156711427 18:39951159-39951181 TTGTTTTAGAAAAAGAAAGAGGG + Intergenic
1156943013 18:42793845-42793867 TATTACTTGATAGAGGAAGATGG + Intronic
1157496255 18:48159676-48159698 AAGTATTTGGAGAAGAAAGAGGG - Intronic
1158310981 18:56158046-56158068 CACCATTTGAAAAAGTAAGAAGG + Intergenic
1158429095 18:57367671-57367693 AAGTACTTGCAAAAAGAAGAGGG + Exonic
1158588138 18:58758458-58758480 TACAATTTGAAGAAAGAAGAGGG - Intergenic
1158892324 18:61884301-61884323 TGGAATTTTAAAAAGTAAGATGG - Intronic
1159067783 18:63588996-63589018 TGGTATTTGGAAAAGGAAGAGGG - Intronic
1159286064 18:66353797-66353819 TAGCATTGGAAAAAGTAACAGGG + Intergenic
1160069481 18:75612881-75612903 TAGAATTTAAAAAAAAAAGAAGG - Intergenic
1160491766 18:79344114-79344136 TAGTATTTGGACCCGGAAGAAGG - Intronic
1161920875 19:7264839-7264861 GGATAGTTGAAAAAGGAAGATGG - Intronic
1162559629 19:11408872-11408894 TTGTCTTTAAGAAAGGAAGAAGG + Intronic
1162682306 19:12355319-12355341 TAGTATTTTAAACAGTAACAAGG + Intronic
1163235371 19:16026582-16026604 TCGTACTTCAAAAAGCAAGAAGG - Intergenic
1164838330 19:31373371-31373393 TAGAAAATGAAAAAGGAAAATGG + Intergenic
1167832649 19:52038616-52038638 TAGATTTTGAATTAGGAAGATGG - Intronic
925071509 2:972205-972227 TAGTATTAGAAAGAGCATGAAGG - Intronic
925774698 2:7323340-7323362 CAGTGTTTGAAAAAGGAAGAAGG - Intergenic
925826347 2:7851384-7851406 TAGGATTTGGGAGAGGAAGATGG + Intergenic
925842783 2:8008068-8008090 GAGTAATTGGAAAAGTAAGAGGG - Intergenic
926618758 2:15026882-15026904 TAGTATTTAAGAAACGAAGCTGG - Intergenic
927392173 2:22607796-22607818 CAGTAATTGAAAAATGAAAAAGG + Intergenic
928357325 2:30630635-30630657 GATTATTTGAAAAAAGTAGAAGG - Intronic
928732488 2:34247699-34247721 TAGTTATTGAAAAAGTAAAATGG - Intergenic
929019277 2:37535458-37535480 TAATATTTTAAAAAATAAGAGGG - Intergenic
929193569 2:39162794-39162816 TTGTATTTGGAAATTGAAGAGGG + Intergenic
931018882 2:58019527-58019549 TAGCATTTGAAAATCAAAGATGG - Intronic
931023987 2:58087441-58087463 TACTATTGAAAAAAGTAAGATGG + Intronic
931168293 2:59775157-59775179 AAGTGTTTGGAAAGGGAAGAAGG - Intergenic
931345738 2:61444354-61444376 GAGAAATCGAAAAAGGAAGATGG + Intronic
931377376 2:61719329-61719351 TAGTATCTGGTAAAGGACGAGGG + Intergenic
931460418 2:62445336-62445358 AAGACTTTGAAAAAGGAAGAGGG - Intergenic
931642079 2:64390698-64390720 TAGTATTAGAAAAAGAAGGAAGG - Intergenic
931738720 2:65222606-65222628 TAGTATTTGAAAATACAATAGGG + Intergenic
932024240 2:68117507-68117529 AAGCATGTGAAATAGGAAGAAGG + Intergenic
932111300 2:69003579-69003601 AAGGATGGGAAAAAGGAAGAGGG - Intergenic
932202409 2:69842914-69842936 TGGAATTTGAAAATGGAAGGTGG - Intronic
932870409 2:75393020-75393042 TAGTTTTTAAAAAAAGAAGTAGG + Intergenic
933402284 2:81813703-81813725 TGCTCTTTGAAAATGGAAGAAGG - Intergenic
933414869 2:81974571-81974593 CAGGACTAGAAAAAGGAAGAGGG - Intergenic
933916335 2:86997685-86997707 TCGTATTTATAACAGGAAGAAGG - Exonic
934006658 2:87772220-87772242 TCGTATTTATAACAGGAAGAAGG + Exonic
935497995 2:103805330-103805352 TAGTGTTTGAGGCAGGAAGAAGG - Intergenic
936785195 2:116086561-116086583 GCTTATTTGAAAAAGGAAAATGG + Intergenic
936942036 2:117893900-117893922 TAGTATCTGAAAAATGAAATAGG - Intergenic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
937590692 2:123610008-123610030 TTTTATTTTTAAAAGGAAGAAGG - Intergenic
937847344 2:126595453-126595475 TAGTGGTTGGGAAAGGAAGATGG - Intergenic
938618305 2:133022317-133022339 AAGTATTTGTATCAGGAAGAAGG + Intronic
938675702 2:133631828-133631850 TAGTAAATGAAAACTGAAGAGGG + Intergenic
939485323 2:142804934-142804956 TAGTACTTGAAAAATGTAAATGG + Intergenic
939590231 2:144055421-144055443 AGGTAATTAAAAAAGGAAGAAGG + Intronic
939695133 2:145314119-145314141 TAGTTTTTGAACAATGAAGTTGG + Intergenic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
940148784 2:150576908-150576930 TAGTATTAGAAAAAGTAAATAGG + Intergenic
940420028 2:153470217-153470239 TAGTATCAAAAAAAGCAAGAGGG - Intergenic
940541766 2:155029449-155029471 TAGCAATTGTAAAAAGAAGATGG - Intergenic
941454559 2:165700053-165700075 TAGCACCTGAAAAAGGATGATGG - Intergenic
941543908 2:166821277-166821299 GTGTGTTTGAAAAAGGAAGTGGG + Intergenic
941580073 2:167285127-167285149 GAGTTTTTGAAAAAAGAAGGTGG + Intergenic
942031677 2:171969077-171969099 TAGTATCTTCAAAAGGCAGATGG - Intronic
942877551 2:180819526-180819548 TATTACTGGAAAAAGGAAGTTGG + Intergenic
942984954 2:182129403-182129425 TGGAATTTGAAAAAGAAACAAGG - Exonic
943122361 2:183752545-183752567 TAGCATTTAAAACAGGCAGATGG - Intergenic
943672456 2:190677949-190677971 TAGTCTTTGAAAAGGGTGGATGG + Intronic
943742779 2:191428518-191428540 CAGTATTTCAGAAAGGAATAGGG + Intergenic
943746779 2:191470100-191470122 CACTATTTAAAAAAGGAAGCAGG - Intergenic
943824048 2:192365386-192365408 TAAAATGTGAAAAAGCAAGAAGG + Intergenic
943952757 2:194151358-194151380 TAATTTATGATAAAGGAAGATGG + Intergenic
944037420 2:195311891-195311913 TACTATTTGAAGAAGAAAGATGG - Intergenic
944559384 2:200920186-200920208 TAGTTTTTAAAAAAGAAATATGG + Intronic
944790910 2:203125108-203125130 TAAAATTTGGAAAATGAAGATGG + Intronic
945112938 2:206380734-206380756 TGGTATTTGATAAGGAAAGAGGG - Intergenic
945360323 2:208888315-208888337 TAGTATTTGAATCATCAAGATGG + Intergenic
946027433 2:216680214-216680236 CAGTATTTGAAAAAAGAGGGAGG - Intronic
946669382 2:222086113-222086135 TAGTATTTGAACAATGAAAAAGG - Intergenic
947035105 2:225844118-225844140 TAATTTTTCTAAAAGGAAGATGG - Intergenic
947154005 2:227142814-227142836 TTGTTTTTCAAAAAAGAAGATGG - Intronic
947251724 2:228113833-228113855 TACTATTTGAGAAAGGGAGAGGG - Intronic
947378480 2:229521656-229521678 TAGTATTTCAAGAAGCAAAAAGG + Intronic
947559560 2:231136229-231136251 TAGTATTTTTAAAAGAAAGTAGG + Intronic
947603653 2:231469657-231469679 TCTTCTTTGAGAAAGGAAGAAGG - Intronic
947947679 2:234120538-234120560 TAGTCTTTGACAATGGAAAATGG - Intergenic
948074299 2:235153802-235153824 TATCATTTGAAAAGGTAAGAAGG - Intergenic
948207410 2:236169451-236169473 TTTTGTTTGAAAATGGAAGAGGG - Intergenic
948500482 2:238389414-238389436 TAAAATTTAAAAAATGAAGATGG - Intronic
948823508 2:240562380-240562402 TAGTAATAGAAAAAGGAGGCTGG - Exonic
1170021623 20:11842651-11842673 TATTATTCAGAAAAGGAAGAAGG - Intergenic
1170034331 20:11973999-11974021 TACTATTAGTACAAGGAAGAAGG + Intergenic
1170371791 20:15656884-15656906 AAGTATTAGAAAAAAAAAGAAGG + Intronic
1170412631 20:16107573-16107595 CAGCATGTGGAAAAGGAAGAAGG + Intergenic
1170838031 20:19901683-19901705 AAGTAATTGAATAAGGAAGAAGG - Intronic
1172008377 20:31832366-31832388 AAATATTTGAAAAATGAAGGAGG - Intronic
1172020511 20:31910539-31910561 TAGTATTTGAACAAGGGGGTAGG - Intronic
1172206975 20:33169731-33169753 AAATATATGAAAAAAGAAGAGGG - Intronic
1172420352 20:34811767-34811789 TAGTATTTAAAAAATTAAGTTGG + Intronic
1172791535 20:37509249-37509271 CAGTAATTGAACAAGGAGGATGG - Intronic
1173007668 20:39152560-39152582 AAGTATATGAAAGAGGATGAGGG + Intergenic
1173092561 20:39987072-39987094 TACTTTTTGAAAGAGTAAGAGGG + Intergenic
1173353533 20:42266143-42266165 TACTATTTCACAAATGAAGAAGG + Intronic
1173400649 20:42723252-42723274 TAATATTGGCAAAATGAAGATGG - Intronic
1173473421 20:43341077-43341099 TGTTATTTGAAAGAGAAAGATGG + Intergenic
1175435902 20:58947763-58947785 AAGAATGTGAAATAGGAAGAAGG - Intergenic
1175629013 20:60516421-60516443 TAATATTTGAAAATGGACTATGG - Intergenic
1177615860 21:23518578-23518600 TAGGATTTGTAAAAAGAAGAGGG + Intergenic
1177678238 21:24330964-24330986 TGATGTTAGAAAAAGGAAGAAGG + Intergenic
1177854764 21:26388305-26388327 AAATATATGAAAAAGGAATAAGG + Intergenic
1178078974 21:29042669-29042691 TAGGATTTGAATAAAGAACAGGG + Intronic
1178306894 21:31498599-31498621 TTGTATTTGAAAAAGGGTGTGGG + Intronic
1178474674 21:32927280-32927302 TAGAATTAGAAAATGGCAGAGGG + Intergenic
1178694059 21:34778046-34778068 GAATATTTAAAAAAGCAAGATGG + Intergenic
1179144698 21:38757574-38757596 TAATATTTTAAAAAGAAAAATGG - Intergenic
1179336192 21:40457205-40457227 CTGTATTTGGAAAAAGAAGAAGG + Intronic
1179347034 21:40568153-40568175 AAGAATTTGATACAGGAAGAAGG - Intronic
1179535840 21:42051338-42051360 TTCTATTTGAATAAGGATGATGG - Intergenic
1179569185 21:42268023-42268045 CAGTATTTGAAACAGCCAGATGG - Intronic
1180894004 22:19314609-19314631 TAGTATTTGATAATGCAACAGGG + Intergenic
1182664652 22:31948769-31948791 TCGTCTTTGAGGAAGGAAGAAGG + Intronic
1183275859 22:36897298-36897320 TTGTATTTTAAAATGCAAGACGG + Intergenic
1185160528 22:49225575-49225597 TAGTATATTAATAAAGAAGAAGG - Intergenic
1185207711 22:49549578-49549600 TGAGATTTGAAAAAGGGAGAGGG - Intronic
949639621 3:6021050-6021072 TAGTATTTGAACAAGGTACCTGG + Intergenic
951026927 3:17840484-17840506 TAGTCTTTGAGAGCGGAAGAGGG + Intronic
951776383 3:26314895-26314917 TTGAATGTGAAAAAGGAACAGGG + Intergenic
952021871 3:29032531-29032553 TAATTTTTTAATAAGGAAGAAGG - Intergenic
952097847 3:29976296-29976318 AAGTACTTAAAGAAGGAAGAAGG - Intronic
952741717 3:36740451-36740473 TAGTATAGGAAAATTGAAGAAGG + Intergenic
953240279 3:41142557-41142579 TTGTATTTGAACATGGAAGTGGG + Intergenic
955015768 3:55067154-55067176 TAGGATTTGGGAAAGAAAGAAGG + Intronic
955090786 3:55748672-55748694 TAGTATTTGATACATGCAGAGGG - Intronic
955261077 3:57391044-57391066 TAGTACTTGGAAAAGGAGAAGGG - Intronic
955944479 3:64179411-64179433 TAGTGTTTCTAAAAGCAAGAAGG - Intronic
956260285 3:67331797-67331819 TACTATTTGAAAAAGGAAAAGGG - Intergenic
956262259 3:67356947-67356969 CTGTAGTTGAAAAAGGAAAATGG - Intergenic
956627855 3:71284160-71284182 TAGGATGAGAAAAAGCAAGATGG + Intronic
956782521 3:72615355-72615377 TAGAATTTGACAAAGCAAGTTGG + Intergenic
957006704 3:74956801-74956823 TATTATTTTTAAAAGGCAGAAGG + Intergenic
957142088 3:76373325-76373347 TAGTAATTGAGAAAGGAAGAGGG + Intronic
957144045 3:76398576-76398598 CAGTGTGTGAAAATGGAAGAGGG - Intronic
957677446 3:83386645-83386667 TAGTATTTCACAACGGAAAATGG - Intergenic
957937837 3:86967309-86967331 TAGTATGTGGCAAAGAAAGAAGG + Intronic
958518492 3:95154218-95154240 TAATATTAGAAAAAGCAAGCGGG + Intergenic
958614598 3:96475561-96475583 TTGTATTTGAGAAAGGATGAAGG + Intergenic
959349866 3:105248708-105248730 TAGAATTTGAAAAATTGAGAAGG + Intergenic
959672896 3:108999156-108999178 AAGTATTTTCAAAAGGAAAAGGG - Intronic
960272433 3:115689660-115689682 CAGAATGTGAAAAAGGAAGGTGG + Intronic
960285403 3:115822755-115822777 CAATATTTGAGAAAGGAAGTTGG + Intronic
960400998 3:117198708-117198730 AAGGAGTTGAAGAAGGAAGAAGG - Intergenic
960547705 3:118935501-118935523 AAGAATTTGCACAAGGAAGATGG + Intronic
960886284 3:122398619-122398641 AATTATTTTAAAAAGTAAGAGGG + Intronic
962318596 3:134373791-134373813 GAGTATTTGGAAAACAAAGAGGG - Intronic
962336828 3:134540711-134540733 TAATTTATGAAAAATGAAGATGG - Intronic
962426240 3:135271471-135271493 TCCTACTTGCAAAAGGAAGAGGG - Intergenic
963002789 3:140698161-140698183 TAATTTCTGAAAAAGAAAGAAGG - Intronic
963390915 3:144663134-144663156 TAGTATTTGTAAGAGGAGGGAGG - Intergenic
963957769 3:151274388-151274410 TAGAAGTGAAAAAAGGAAGAGGG - Intronic
964435320 3:156645219-156645241 TATTAATTGAAAATGGCAGAAGG - Intergenic
964690960 3:159449154-159449176 TAGCATTTGAGCAAGGCAGAAGG - Intronic
964711750 3:159678350-159678372 TTGTACTTGAAATAGTAAGAAGG - Intronic
965132639 3:164721561-164721583 AAATATTTGAAAATGGGAGATGG - Intergenic
965149675 3:164954106-164954128 TAGAAATTGAAGTAGGAAGAGGG - Intergenic
965424997 3:168511622-168511644 TGGCAATTGAAAAAAGAAGAGGG - Intergenic
965780409 3:172279833-172279855 TAATATTTCAAAATTGAAGATGG + Intronic
966019753 3:175193613-175193635 TAATATTTGAAACAGGTAGAGGG - Intronic
966377462 3:179311502-179311524 TAGTATTTGAAAAATGGAGAGGG - Intergenic
967274521 3:187760871-187760893 TGGGATTTGAAAAAGGAAGATGG + Intergenic
967287155 3:187883639-187883661 TATTAATTAAAAAAAGAAGATGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967548417 3:190760317-190760339 TGTTATTAGAAAAAGGAAAAGGG - Intergenic
968219279 3:196923053-196923075 TAGTATTAGAAAATGGTATAAGG - Intronic
969934792 4:10669568-10669590 TAGTACATGAAAAAGAATGAGGG + Intronic
970161174 4:13190733-13190755 TATTGTTTGATAAATGAAGAAGG - Intergenic
970267775 4:14308047-14308069 TGGTAAATGAGAAAGGAAGAAGG - Intergenic
970286064 4:14517185-14517207 TGGGATTTAAAAAAGTAAGAAGG + Intergenic
970567736 4:17348972-17348994 TAGAATTTGAAAAAAGCATAGGG - Intergenic
970806977 4:20048568-20048590 TGATATTTGAAAAAGAAAGTTGG - Intergenic
970983636 4:22129959-22129981 TTTTATTAGAAAAAAGAAGAGGG - Intergenic
971020961 4:22534888-22534910 AAGTAATTCCAAAAGGAAGATGG - Intergenic
971394054 4:26212545-26212567 CAGTATGTGAAAAAAGAAGGTGG - Intronic
971681946 4:29711337-29711359 TAGAATTTGGAAAGGCAAGAGGG - Intergenic
971710976 4:30112179-30112201 TAGTATTTGAAAACACAACAGGG + Intergenic
971877473 4:32324615-32324637 TAGACTTTGGAAAAGGAACAAGG - Intergenic
971937438 4:33170321-33170343 TGGGATTAGAAAGAGGAAGATGG + Intergenic
972263224 4:37432836-37432858 AAGCAAATGAAAAAGGAAGAGGG + Intronic
972335418 4:38103649-38103671 TAGTTTTTAAAATAAGAAGATGG + Intronic
972722945 4:41719052-41719074 AGGAATTTGAAAAAGGAGGAAGG + Intergenic
972793775 4:42397447-42397469 GCGTCTTTTAAAAAGGAAGAGGG - Intergenic
972908979 4:43789825-43789847 CAGTACTAGCAAAAGGAAGAAGG - Intergenic
973763759 4:54144990-54145012 TTGTATGTGCTAAAGGAAGATGG + Intronic
974154064 4:58047618-58047640 AATTATCTAAAAAAGGAAGATGG - Intergenic
974616834 4:64297172-64297194 TAGTAGTAGAAAAAACAAGAGGG + Intronic
975484273 4:74916639-74916661 TAATATTGGAAAAGAGAAGATGG - Intergenic
976621979 4:87137622-87137644 TAGTAGTTTAAAAAGGACCAGGG - Exonic
976765591 4:88594142-88594164 TACTTTTTGAAAAAGAAACAGGG + Intronic
977886968 4:102263027-102263049 GAGTAATAGAAAATGGAAGATGG - Exonic
978242291 4:106530422-106530444 CAGAATTTAAAAAAGTAAGAGGG + Intergenic
978469086 4:109042049-109042071 TAAAATTTTAAAAAGGAACAAGG - Intronic
979007966 4:115327421-115327443 TAGTATTTTTAATAGCAAGATGG + Intergenic
979046920 4:115878829-115878851 TAGCATTTGAAACAGGTACATGG + Intergenic
979102324 4:116634650-116634672 TAGTCTTTGCAAAATAAAGAAGG + Intergenic
979419387 4:120485224-120485246 TTTTATTTGAAAATGGAACATGG + Intergenic
979584081 4:122394401-122394423 GAGTATTTGTAAGAGGAAAAAGG + Intronic
979593996 4:122512680-122512702 TAATAGTCAAAAAAGGAAGAAGG - Intergenic
979857299 4:125650488-125650510 TCTTTTTTGAAAAAGGGAGAGGG - Intergenic
980315534 4:131194856-131194878 TATTTTTTGAACAAGGAACAAGG - Intergenic
980392121 4:132160013-132160035 GAGTAATTGAAAAAGAAAAATGG - Intergenic
980487799 4:133482661-133482683 TAGTATTTTAATGAGAAAGAGGG - Intergenic
980985780 4:139692756-139692778 TCTTATCTGAAAGAGGAAGAAGG - Intronic
981244704 4:142521628-142521650 TAATCTCTGAAGAAGGAAGAAGG - Intronic
981572004 4:146161579-146161601 TAGAATTTGGGACAGGAAGATGG - Intergenic
982482382 4:155928149-155928171 TAGTATTTGAAAAAGGAAGAGGG - Intronic
982804924 4:159751548-159751570 TAGACTAAGAAAAAGGAAGAAGG - Intergenic
983050868 4:163046044-163046066 TCGTATTTGGAAAAGGTGGAGGG - Intergenic
983560255 4:169093979-169094001 TAGTAACTGGAAGAGGAAGAGGG + Intergenic
983782332 4:171685646-171685668 TAGCATTTGAAACAGAGAGAAGG - Intergenic
984576043 4:181449395-181449417 AATTATTTCAAAAAGGAAGGGGG + Intergenic
984610148 4:181828364-181828386 TAGTATTGAAAGAAAGAAGAAGG - Intergenic
985372961 4:189306759-189306781 TAATATTTTTAAAAGGAAGCAGG + Intergenic
986628384 5:9744941-9744963 TTCTGTTTGAAAAACGAAGATGG + Intergenic
987577276 5:19745889-19745911 TATTTTTTAAAAATGGAAGATGG - Intronic
987620332 5:20331874-20331896 TAATATTAGAAAAGAGAAGAAGG + Intronic
987973975 5:24988165-24988187 TAGTAGCTTAAAAAGCAAGAGGG - Intergenic
988691872 5:33580586-33580608 TAATATTTTAAAACAGAAGATGG + Intronic
988702644 5:33690536-33690558 GAATATGTCAAAAAGGAAGATGG + Intronic
989154421 5:38330564-38330586 AGGTATTTTAAACAGGAAGATGG - Intronic
989280851 5:39641584-39641606 TATTAATTGAAAATGGAAGTCGG - Intergenic
989448803 5:41562972-41562994 GAGTATTTTAAGAAGGAAGTAGG - Intergenic
989521260 5:42403349-42403371 TAGCATCTGACTAAGGAAGAAGG + Intergenic
989732307 5:44663708-44663730 AAGGGTTTGAAAAAGAAAGAAGG - Intergenic
990516153 5:56532757-56532779 GAGTATTTGCCAAAGGAAGTTGG + Intronic
990842677 5:60101295-60101317 GAGTACTTGAAAATGGATGAAGG - Intronic
990859410 5:60310140-60310162 GAGAATTTGAAGAAGGAAAAGGG - Intronic
992727427 5:79622455-79622477 TAGTATTTGCAAAATAAAAAGGG - Intronic
992915294 5:81444704-81444726 TACTCTTGGTAAAAGGAAGATGG + Intronic
993275733 5:85854991-85855013 TTGTATTTTAAAAAGAAAAATGG - Intergenic
993296134 5:86143744-86143766 TATTTTCTGAGAAAGGAAGAAGG - Intergenic
993425677 5:87761503-87761525 TAATACTTGTAAATGGAAGAAGG + Intergenic
994282536 5:97922544-97922566 CTATATTTGAAAAAGTAAGAGGG + Intergenic
994387040 5:99144692-99144714 TAGTATTTGATAAAACAACAGGG + Intergenic
994500883 5:100575968-100575990 TAGAATTTGGAAAATGAAGAGGG - Intronic
994817883 5:104607826-104607848 TAGTTTTTTAAAAAGGAAGGTGG - Intergenic
994898058 5:105730973-105730995 TGGTATTTGAAAAATGAGGCGGG + Intergenic
995126134 5:108578379-108578401 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
995195742 5:109365495-109365517 TAGAAGTTCAAAAAGGAAGCTGG + Intronic
995359259 5:111275989-111276011 TAATATTTGATACAAGAAGATGG - Intronic
995532037 5:113101382-113101404 TAGAATTTGAAAAAAAAAAATGG - Intronic
995541395 5:113189731-113189753 TAACCTTTGAAAAAGGAAGTAGG + Intronic
995630114 5:114123801-114123823 ATGTATTTGAAAAAGGAAGTAGG - Intergenic
995773523 5:115699378-115699400 TTGTTTTTGAAACAGGAAGCAGG + Intergenic
996080207 5:119250770-119250792 TAGCATTGGGAAAAGGAAGAAGG + Intergenic
996662088 5:126016362-126016384 TAGTGTTTTAAAAAAGAATAAGG + Intergenic
996673060 5:126141946-126141968 TATTATTTAAAAAGAGAAGAGGG + Intergenic
996940238 5:128995812-128995834 GAGTAGTTGAAAAAAGATGAAGG + Intronic
996966858 5:129316673-129316695 GTGTATTTGAAAAAGTAAGAGGG - Intergenic
996992437 5:129651103-129651125 TAGTGTTTGAAGTAGGCAGAAGG - Intronic
997420212 5:133760729-133760751 TAGAGTGAGAAAAAGGAAGAGGG + Intergenic
998707394 5:144778897-144778919 TATTATTTGAAACAGTATGAAGG - Intergenic
998882621 5:146658683-146658705 TTTCTTTTGAAAAAGGAAGAAGG - Intronic
999049917 5:148511159-148511181 AAATATTCGAAAAAAGAAGAAGG - Intronic
999237344 5:150106792-150106814 AAGTATGTGGAACAGGAAGAAGG - Intronic
999363282 5:151004176-151004198 TAAAATTTAAAAAAAGAAGAAGG + Intergenic
999686474 5:154107770-154107792 TAGTATCTGCAAAAGGAAGGAGG + Intronic
999857694 5:155613099-155613121 TAGGATTTTAGAGAGGAAGATGG + Intergenic
1000051999 5:157571465-157571487 TAGTAAATGAAAGAGGAAGTTGG + Intronic
1000616117 5:163428791-163428813 AAGCATTTTAAAAAGGAAAAGGG - Intergenic
1000833211 5:166128460-166128482 TAATAGGTGATAAAGGAAGAGGG + Intergenic
1001214404 5:169841979-169842001 TAATGTTTAAAAAAGGATGAGGG + Intronic
1002651940 5:180704379-180704401 GAGGATTTTAAAAAGGAATATGG - Intergenic
1003341286 6:5223746-5223768 AATTGTTTTAAAAAGGAAGAGGG + Intronic
1003850936 6:10221750-10221772 TATTATTAGAGAAAGAAAGAGGG + Intergenic
1004289926 6:14357417-14357439 TATTATTAGAGAAAGGAAGATGG - Intergenic
1004616121 6:17291133-17291155 TAATAATTAAAAAAGGAAGCAGG - Intronic
1005247280 6:23902038-23902060 AAGTATTTGAAAAATCATGAGGG + Intergenic
1005384941 6:25276887-25276909 CATTATTTTGAAAAGGAAGATGG - Intergenic
1005407002 6:25500014-25500036 TGGCATTTTAAAAAGTAAGAGGG + Intronic
1005882640 6:30072574-30072596 GAATGTATGAAAAAGGAAGAGGG + Intronic
1007031003 6:38626374-38626396 TAGTATTTGAAAACAGAACAAGG - Intronic
1007067886 6:39011134-39011156 TAGTGAGTGAAAGAGGAAGACGG - Intronic
1007960322 6:45953095-45953117 TAGTATTTGAACCAAGCAGATGG + Intronic
1008073375 6:47119944-47119966 TAATAATAGAAAAAGGAGGAGGG + Intergenic
1008286155 6:49653676-49653698 TCTTATTTCAAAAAGGAAAAAGG + Intergenic
1008315635 6:50036755-50036777 AAGTCTTTATAAAAGGAAGATGG + Intergenic
1008383001 6:50855036-50855058 TAGTCCTTGAATAAGTAAGATGG + Intergenic
1008744602 6:54654452-54654474 TAGTATTTGCCAAATGAACATGG + Intergenic
1008767686 6:54939386-54939408 TATTATGTGAAAAATGATGATGG + Intronic
1008827791 6:55719301-55719323 TACTATGTGAAAAATTAAGAAGG + Intergenic
1009349433 6:62655494-62655516 AATTAATTGAAAAATGAAGAAGG - Intergenic
1009602126 6:65815114-65815136 TAAAATTTGAAAAAGAAAGAAGG + Intergenic
1009796459 6:68475065-68475087 AAGTATTTGAAAAAAGTAGATGG - Intergenic
1009818038 6:68761810-68761832 TGGTAATTGAAAATGGAAAATGG + Intronic
1009884991 6:69615553-69615575 AAGTAAGTTAAAAAGGAAGAAGG + Intergenic
1010407562 6:75522282-75522304 TATTATAGGAAAAGGGAAGATGG - Intergenic
1010599673 6:77808566-77808588 TAATGTTTGCAAAAGGAAAAAGG + Intronic
1010832400 6:80546880-80546902 TAATGTTTGAAAGATGAAGATGG + Intergenic
1010877968 6:81131927-81131949 TAGTATTTTAAAAAGGAAAGAGG - Intergenic
1011390641 6:86848806-86848828 TAGAATTTAAAAAATGCAGAGGG - Intergenic
1012060395 6:94471340-94471362 TAGTACTAGAATAAGGAGGAGGG - Intergenic
1012661252 6:101896607-101896629 TAGAATTTGAAAAATAAAGATGG - Intronic
1013382294 6:109587102-109587124 TAATAATTCAAAAAGCAAGATGG - Intronic
1013919530 6:115385890-115385912 TGTTATTTTAAAAAGGAAAATGG + Intergenic
1014460569 6:121689947-121689969 TAGAAGTGGAAAAAGGGAGATGG - Intergenic
1014588622 6:123233054-123233076 GCGAATTTGATAAAGGAAGAGGG - Intronic
1014596686 6:123352169-123352191 TATAATTTGAAAAATAAAGATGG - Intronic
1014649927 6:124023449-124023471 TAGTATTTGAAAGATGGAAAAGG - Intronic
1014677757 6:124388568-124388590 TTGTATTTATAAAAGGAAGTAGG - Intronic
1014776288 6:125513436-125513458 TAAGATTTGAGAAAAGAAGAAGG + Intergenic
1015685086 6:135850566-135850588 TAGTATTTGAAAAAGGAATGTGG + Intergenic
1015777413 6:136827963-136827985 TATTTTTTAAAAAAGAAAGAAGG - Intronic
1015963331 6:138672653-138672675 TAGTATTTGAAATTGAAATATGG - Intronic
1016308632 6:142710223-142710245 TAGTAGTTGTAAAGGGGAGATGG - Intergenic
1016652421 6:146477944-146477966 TATTATTTCAAAAAGCAATATGG - Intergenic
1017175876 6:151504506-151504528 TAAAATTTTAAAAAGGAAGAAGG + Intronic
1017331230 6:153199908-153199930 AAGAATTTGAAAAGGGAAAATGG - Intergenic
1017355966 6:153508876-153508898 TGTTATTTAAAAAAGGAAGCTGG + Intergenic
1017618652 6:156272601-156272623 TAATTTTTTAAAAACGAAGATGG - Intergenic
1017999655 6:159568050-159568072 TAGTATCTGGAAAAGGCATAGGG + Intergenic
1018613810 6:165666268-165666290 TATTATTTAAAAAAGGAAACAGG - Intronic
1018657914 6:166057601-166057623 TAGAAGCAGAAAAAGGAAGAGGG + Intergenic
1019082402 6:169443938-169443960 CATTATTTATAAAAGGAAGATGG + Intergenic
1020037934 7:4976358-4976380 CTGCATTTGAAAATGGAAGAGGG + Intergenic
1020159767 7:5761059-5761081 CTGCATTTGAAAATGGAAGAGGG - Exonic
1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG + Intronic
1020590947 7:10136261-10136283 CAGTCTTTGAACTAGGAAGAGGG + Intergenic
1021274397 7:18631657-18631679 TTGAATTTGAAAAAAAAAGATGG - Intronic
1022129032 7:27386835-27386857 TTGAACTTGAAAAAGCAAGAAGG - Intergenic
1022317542 7:29259576-29259598 TACTATTTGCAAAAAGAAGTTGG + Intronic
1022359971 7:29648588-29648610 CAGGATTTGAAGAAGGGAGAAGG - Intergenic
1022895302 7:34744604-34744626 TAGTGTTTCAAACAGGAAGAAGG - Intronic
1023469789 7:40504230-40504252 TTGTTTTTTAAAAAAGAAGAAGG - Intronic
1024363988 7:48500479-48500501 TTATTTTTCAAAAAGGAAGATGG - Intronic
1024452378 7:49562953-49562975 TATTATTTTAAAAAGTAGGAAGG - Intergenic
1024662420 7:51511077-51511099 TTCTATTTGAAAAAAGGAGAGGG - Intergenic
1024954050 7:54897298-54897320 TACTGTTTAAAAAAGGAAGAAGG + Intergenic
1026327718 7:69325049-69325071 TAGTATTTACTCAAGGAAGATGG + Intergenic
1026376666 7:69758447-69758469 GATCATTTGAAAAAGGAAGCAGG - Intronic
1027379851 7:77595970-77595992 TAGCAACTGAAGAAGGAAGAGGG - Intronic
1027512546 7:79101420-79101442 TGGTTTTAGAAAAAGGAAAATGG + Intronic
1027533094 7:79360421-79360443 TAGAACATCAAAAAGGAAGAAGG + Intronic
1027613500 7:80392029-80392051 CAGTTTTTGAAAAATGAAGAAGG + Intronic
1027800570 7:82744789-82744811 CAGAATTTGCAAAAGGGAGAAGG + Intergenic
1028467854 7:91172935-91172957 TAGTTTTTGAACGAGGATGAAGG + Intronic
1028583934 7:92434696-92434718 TTGTCTTTGAAGATGGAAGAAGG + Intergenic
1028676721 7:93472708-93472730 TTGAATTTGTAAAATGAAGATGG - Intronic
1028840685 7:95426878-95426900 TTATCTTTGAAAAAGGTAGATGG - Intronic
1029121179 7:98269399-98269421 TAGCATTAGAAAAAGGGATATGG - Intronic
1030154854 7:106444265-106444287 TAGTTTTTGAATATGGATGATGG + Intergenic
1030324171 7:108202637-108202659 TAGTTTTGTGAAAAGGAAGAAGG + Intronic
1030741665 7:113117081-113117103 AAGCATGTGAAATAGGAAGAAGG - Exonic
1030963057 7:115950933-115950955 TAATAGTTGAAAGAAGAAGAAGG - Exonic
1030988869 7:116275736-116275758 CAGGATTTGAAAGAGGAAGATGG + Intergenic
1031132877 7:117853273-117853295 TAAAAAATGAAAAAGGAAGAGGG - Intronic
1031339749 7:120584528-120584550 TAGCATTTGAAACAGGTACATGG + Intronic
1031344787 7:120651746-120651768 TAAATTTAGAAAAAGGAAGATGG - Intronic
1032100276 7:128970706-128970728 TAGTTTTTAAAAAAGGAAATAGG - Intronic
1032317511 7:130853216-130853238 TAGGATGGGAAAAGGGAAGAAGG + Intergenic
1032378673 7:131451955-131451977 TAGCATTTGGCAAATGAAGAAGG - Intronic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1032425987 7:131822511-131822533 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
1032567796 7:132965828-132965850 CAGTGTTTGAAACAGGCAGAGGG + Intronic
1032677046 7:134140747-134140769 TAGTATTTTAAGAATGAAAATGG - Intronic
1032866614 7:135931808-135931830 TAAAATTTTAAAAAGCAAGAGGG - Intronic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1033078896 7:138276066-138276088 TAATATTTTAAAAAGTAAGATGG + Intergenic
1033515081 7:142097420-142097442 TCCTGTTTGAAAAAGGAAAAGGG + Intronic
1033671197 7:143494866-143494888 TAGTGCTTGGAAAAGTAAGAAGG - Intergenic
1034172774 7:149075613-149075635 TAGGATTTGACAAAGTTAGATGG - Intronic
1034280873 7:149853384-149853406 TAGTAATGGAAAAAGAAGGAGGG - Intronic
1035094065 7:156339125-156339147 TATGATTTAAAAAGGGAAGAAGG + Intergenic
1037096715 8:14994807-14994829 TAATATTTGAGAAATGAAGCTGG - Intronic
1037537929 8:19844447-19844469 TAGCAGTGGAAAATGGAAGAGGG - Intronic
1038039434 8:23711326-23711348 GAGTATTTGAAAAATTAACATGG + Intergenic
1039139977 8:34375830-34375852 AAGGATTTGAAAAAGGTGGAGGG - Intergenic
1039177306 8:34824453-34824475 TGGAATTTGGAAAAGGAGGATGG - Intergenic
1039562620 8:38525324-38525346 TAGTATATAAAAAATGTAGAGGG - Intronic
1039705942 8:40007542-40007564 TAGGATTAGAAAAAGAAAAATGG + Intronic
1040598456 8:48862123-48862145 TGGTTTTTGCAAAAGCAAGAAGG - Intergenic
1040604912 8:48921899-48921921 TGGCTTTTGAAAAAGGAAGGGGG + Intergenic
1041206355 8:55502102-55502124 AAATATTTGAAAAAAGAGGATGG - Intronic
1041977725 8:63818523-63818545 GGGTAATTTAAAAAGGAAGAAGG + Intergenic
1042465280 8:69122684-69122706 TGTTATGTGAAAAAGGATGATGG + Intergenic
1043057732 8:75461338-75461360 TGGGCTTTGAAGAAGGAAGATGG - Intronic
1043088091 8:75862093-75862115 GAGTAATTGAAAAAGGAAAGAGG - Intergenic
1043282552 8:78486245-78486267 TAGAATATGAAAAAAGAATATGG - Intergenic
1043468631 8:80539289-80539311 TAGTAATTTTAAAATGAAGATGG - Intergenic
1044400271 8:91762410-91762432 TATTATTTGAAAAAGTTATATGG - Intergenic
1044845144 8:96372999-96373021 TAGTATTTGATACAGGAATTTGG - Intergenic
1045370787 8:101520764-101520786 TAATGTTTCAAGAAGGAAGAGGG - Intronic
1045820161 8:106327960-106327982 TTGTATTTTAAAAAGGATGAGGG + Intronic
1046256113 8:111697901-111697923 AGGTATTTGAGAAAGGAAGCTGG - Intergenic
1046260501 8:111760857-111760879 TAGTAATTTAAACAGAAAGATGG + Intergenic
1046358083 8:113114360-113114382 AGGAATTTGAAAAGGGAAGAGGG + Intronic
1048564558 8:135581758-135581780 TATTTTTGTAAAAAGGAAGAAGG - Intronic
1048851566 8:138650232-138650254 TGGTTTCTGAACAAGGAAGAAGG + Intronic
1049863886 8:144920717-144920739 TATAATATGAAAAAGGCAGAGGG + Intergenic
1050548464 9:6728903-6728925 TTGTATGAAAAAAAGGAAGAAGG + Intronic
1050721459 9:8595294-8595316 TAGTTTTTTAAAAAACAAGAAGG + Intronic
1050734419 9:8747274-8747296 TAGAATTAGGAAAAGGAAAAAGG + Intronic
1050875859 9:10634984-10635006 TAGAATTTGAAAAAGCAAAATGG - Intergenic
1051316882 9:15846461-15846483 CAGTATTTGAAAAAATAAAATGG + Intronic
1051548374 9:18302185-18302207 TAGAATTTGGGAAAGGAAGAGGG + Intergenic
1052149075 9:25090187-25090209 TAGTATTTCAAAAAGGAACTTGG + Intergenic
1052520802 9:29546603-29546625 TAGGATGTGAAAAAGGGGGATGG - Intergenic
1052631440 9:31046478-31046500 AATTATTTTACAAAGGAAGAAGG - Intergenic
1055699605 9:78928703-78928725 TAGTTTGTTAAAAAGGCAGAGGG - Intergenic
1056921263 9:90791316-90791338 TACTATTCCAAAAAGGAGGAGGG + Intergenic
1057244007 9:93438920-93438942 TAGTGTTTGGAATAGAAAGAGGG + Intergenic
1058075848 9:100650121-100650143 AAGTATTTGGAAATGGAAAAGGG + Intergenic
1058409088 9:104710816-104710838 TAATATTTTAAAAACGAAAATGG - Intergenic
1058564902 9:106272544-106272566 TTGTATTTGAGAAAGAGAGAAGG + Intergenic
1058874206 9:109228816-109228838 TAGTATTTTAAAGAGTAGGAAGG - Intronic
1059748723 9:117228343-117228365 TAGGTTTTGAAAAAGGTTGATGG - Intronic
1060039588 9:120288393-120288415 TAGTTTGTGAACAAGGAACATGG - Intergenic
1060254756 9:122017547-122017569 AATTGTTTGAAACAGGAAGACGG - Intronic
1060352959 9:122875616-122875638 AAGTGTTTGAAAGAGGAAGCTGG + Intronic
1062727049 9:138080326-138080348 AGGTATTTGAAAAAGGGAGCCGG + Intronic
1185882682 X:3755412-3755434 TTGTCTTTCAAAAAGAAAGAAGG - Intergenic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1188053749 X:25517673-25517695 TAATATTTGAGACAGGGAGATGG + Intergenic
1188368574 X:29340714-29340736 CTGTATTTCAGAAAGGAAGAAGG - Intronic
1188391283 X:29623350-29623372 TGGTATTTGAGAAAGGATGAAGG - Intronic
1188424822 X:30034622-30034644 TAGTATTTGATAACGCAATAGGG - Intergenic
1188957204 X:36447909-36447931 TAGTATTTTAAAATGTGAGAAGG - Intergenic
1189307440 X:39997495-39997517 AAGGAATTGCAAAAGGAAGAGGG - Intergenic
1189450693 X:41126430-41126452 TATAAAATGAAAAAGGAAGAGGG - Intronic
1190035245 X:47017040-47017062 TAGTAACTGAAAATGGATGAGGG + Intronic
1192296161 X:69850838-69850860 TAGTATGTGCAAAAGCATGAAGG - Intronic
1192382237 X:70629554-70629576 TTGTCTTTCAAAAAGGAAAAGGG + Intronic
1192670003 X:73129717-73129739 TATTATTAGAAAAAGAAAAAAGG - Intergenic
1193586282 X:83325661-83325683 TAGTATTTTAAAAACAAAGCTGG + Intergenic
1193819015 X:86139424-86139446 TAGTAGTAGAAAAGGGAAGAGGG - Intergenic
1193914196 X:87345883-87345905 TATTATTTCTAAAAGGAAGCGGG - Intergenic
1193967612 X:88007698-88007720 TAGCATTAGAAAATGGAAGAAGG - Intergenic
1194037171 X:88889543-88889565 TAGTAGTTGAACAATGAAGTTGG - Intergenic
1194262230 X:91710520-91710542 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1194390087 X:93306409-93306431 TATTTTTTTAAAAAGCAAGAAGG - Intergenic
1194736962 X:97523618-97523640 CAATATTTGAAAAATGAAAAAGG + Intronic
1194966440 X:100293748-100293770 AAGTATTTGGATAGGGAAGAAGG + Exonic
1195118031 X:101719309-101719331 TAGTATTTGATAACTCAAGAGGG + Intergenic
1195719047 X:107848206-107848228 TAGAAGTTGAAAGAGAAAGAGGG + Intronic
1196153624 X:112403198-112403220 AAGTAAATGAAAAAGAAAGAAGG - Intergenic
1196264987 X:113633038-113633060 AAGTAATTGAAAAAGGAGGGTGG + Intergenic
1196647353 X:118132200-118132222 AAGTATATGAAAAGGGAAAAAGG + Intergenic
1197677468 X:129346089-129346111 TAGTATTGCAAAAGGGAAGGTGG + Intergenic
1198089893 X:133318167-133318189 TAGAATTGCAAAGAGGAAGATGG - Intronic
1198205755 X:134462746-134462768 AAATTTTTTAAAAAGGAAGAGGG - Intronic
1198220199 X:134592276-134592298 AAGTATCTGAAAATGGATGATGG - Intronic
1198802743 X:140464147-140464169 TAGTATTTGAATAAGGGAGGTGG + Intergenic
1199448144 X:147950401-147950423 TAGTATTTGAAAACAGAAATTGG + Exonic
1200581526 Y:4955353-4955375 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1200782292 Y:7227722-7227744 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1200782314 Y:7227902-7227924 TTGTCTTTCAAAAAGAAAGAAGG + Intergenic
1202096945 Y:21261084-21261106 TATTTGTTAAAAAAGGAAGAAGG + Intergenic