ID: 982488330

View in Genome Browser
Species Human (GRCh38)
Location 4:155996840-155996862
Sequence TAACATACTTGGTTGACATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982488330_982488333 -5 Left 982488330 4:155996840-155996862 CCTAATGTCAACCAAGTATGTTA No data
Right 982488333 4:155996858-155996880 TGTTATCTAAAATCTCCTATGGG No data
982488330_982488332 -6 Left 982488330 4:155996840-155996862 CCTAATGTCAACCAAGTATGTTA No data
Right 982488332 4:155996857-155996879 ATGTTATCTAAAATCTCCTATGG No data
982488330_982488335 23 Left 982488330 4:155996840-155996862 CCTAATGTCAACCAAGTATGTTA No data
Right 982488335 4:155996886-155996908 CTATTTTCACTTTTAATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982488330 Original CRISPR TAACATACTTGGTTGACATT AGG (reversed) Intergenic
No off target data available for this crispr