ID: 982488333

View in Genome Browser
Species Human (GRCh38)
Location 4:155996858-155996880
Sequence TGTTATCTAAAATCTCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982488330_982488333 -5 Left 982488330 4:155996840-155996862 CCTAATGTCAACCAAGTATGTTA No data
Right 982488333 4:155996858-155996880 TGTTATCTAAAATCTCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982488333 Original CRISPR TGTTATCTAAAATCTCCTAT GGG Intergenic
No off target data available for this crispr