ID: 982489110

View in Genome Browser
Species Human (GRCh38)
Location 4:156006407-156006429
Sequence CCACAGAGGCTGCGCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982489110_982489116 7 Left 982489110 4:156006407-156006429 CCAGCGCTGCGCAGCCTCTGTGG No data
Right 982489116 4:156006437-156006459 CTCTCCTTAGCCCCGCCATGAGG No data
982489110_982489123 24 Left 982489110 4:156006407-156006429 CCAGCGCTGCGCAGCCTCTGTGG No data
Right 982489123 4:156006454-156006476 ATGAGGATCGGCGTTCTCACAGG No data
982489110_982489118 12 Left 982489110 4:156006407-156006429 CCAGCGCTGCGCAGCCTCTGTGG No data
Right 982489118 4:156006442-156006464 CTTAGCCCCGCCATGAGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982489110 Original CRISPR CCACAGAGGCTGCGCAGCGC TGG (reversed) Intergenic
No off target data available for this crispr