ID: 982497825

View in Genome Browser
Species Human (GRCh38)
Location 4:156113115-156113137
Sequence CTGCTGTTTTTGACCAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982497821_982497825 20 Left 982497821 4:156113072-156113094 CCATTAAGATTACAGTCGTTTAT No data
Right 982497825 4:156113115-156113137 CTGCTGTTTTTGACCAAAAGTGG No data
982497823_982497825 -3 Left 982497823 4:156113095-156113117 CCTTCTTAGGTAACTAATACCTG No data
Right 982497825 4:156113115-156113137 CTGCTGTTTTTGACCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982497825 Original CRISPR CTGCTGTTTTTGACCAAAAG TGG Intergenic
No off target data available for this crispr