ID: 982504651

View in Genome Browser
Species Human (GRCh38)
Location 4:156201642-156201664
Sequence CTGGATATTCCCATGCACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982504650_982504651 -10 Left 982504650 4:156201629-156201651 CCATCATTTGCTTCTGGATATTC No data
Right 982504651 4:156201642-156201664 CTGGATATTCCCATGCACAATGG No data
982504646_982504651 26 Left 982504646 4:156201593-156201615 CCATTTGCTATTCAGGAATACCA No data
Right 982504651 4:156201642-156201664 CTGGATATTCCCATGCACAATGG No data
982504648_982504651 -1 Left 982504648 4:156201620-156201642 CCTGCAGATCCATCATTTGCTTC No data
Right 982504651 4:156201642-156201664 CTGGATATTCCCATGCACAATGG No data
982504645_982504651 30 Left 982504645 4:156201589-156201611 CCTTCCATTTGCTATTCAGGAAT No data
Right 982504651 4:156201642-156201664 CTGGATATTCCCATGCACAATGG No data
982504647_982504651 6 Left 982504647 4:156201613-156201635 CCACTTACCTGCAGATCCATCAT No data
Right 982504651 4:156201642-156201664 CTGGATATTCCCATGCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982504651 Original CRISPR CTGGATATTCCCATGCACAA TGG Intergenic
No off target data available for this crispr