ID: 982516648

View in Genome Browser
Species Human (GRCh38)
Location 4:156359601-156359623
Sequence CTTTGGAAGGCGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318316
Summary {0: 4, 1: 1069, 2: 27256, 3: 105944, 4: 184043}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982516648_982516658 -6 Left 982516648 4:156359601-156359623 CCACCCACCTTCGCCTTCCAAAG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043
Right 982516658 4:156359618-156359640 CCAAAGTGCTGGGATTATAGGGG 0: 243
1: 3205
2: 3128
3: 1987
4: 1971
982516648_982516656 -7 Left 982516648 4:156359601-156359623 CCACCCACCTTCGCCTTCCAAAG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043
Right 982516656 4:156359617-156359639 TCCAAAGTGCTGGGATTATAGGG 0: 18
1: 553
2: 4659
3: 4493
4: 3486
982516648_982516655 -8 Left 982516648 4:156359601-156359623 CCACCCACCTTCGCCTTCCAAAG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043
Right 982516655 4:156359616-156359638 TTCCAAAGTGCTGGGATTATAGG 0: 1158
1: 38766
2: 329426
3: 249898
4: 134520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982516648 Original CRISPR CTTTGGAAGGCGAAGGTGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr