ID: 982524140

View in Genome Browser
Species Human (GRCh38)
Location 4:156456365-156456387
Sequence CTGGTGAGGTTGAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982524135_982524140 28 Left 982524135 4:156456314-156456336 CCTGGCCAAAGTCAGAATGGCGA No data
Right 982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG No data
982524136_982524140 23 Left 982524136 4:156456319-156456341 CCAAAGTCAGAATGGCGATTATT No data
Right 982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982524140 Original CRISPR CTGGTGAGGTTGAGGAAAAA AGG Intergenic
No off target data available for this crispr