ID: 982525303

View in Genome Browser
Species Human (GRCh38)
Location 4:156470485-156470507
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982525303_982525306 30 Left 982525303 4:156470485-156470507 CCTGAGATATTATTGAAGGTCAA No data
Right 982525306 4:156470538-156470560 TTTGTCTTGCTTCAAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982525303 Original CRISPR TTGACCTTCAATAATATCTC AGG (reversed) Intergenic
No off target data available for this crispr