ID: 982525346

View in Genome Browser
Species Human (GRCh38)
Location 4:156470939-156470961
Sequence ATTCAGAAGCAGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982525338_982525346 9 Left 982525338 4:156470907-156470929 CCCTCATAGAATGAGAGGGTCCA No data
Right 982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG No data
982525339_982525346 8 Left 982525339 4:156470908-156470930 CCTCATAGAATGAGAGGGTCCAG No data
Right 982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982525346 Original CRISPR ATTCAGAAGCAGAAGAAGGA AGG Intergenic
No off target data available for this crispr