ID: 982529833

View in Genome Browser
Species Human (GRCh38)
Location 4:156525668-156525690
Sequence AACACAAGGCTGTTTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982529828_982529833 17 Left 982529828 4:156525628-156525650 CCCAATGCTTGGTCTAGGGACTT No data
Right 982529833 4:156525668-156525690 AACACAAGGCTGTTTTTCACAGG No data
982529829_982529833 16 Left 982529829 4:156525629-156525651 CCAATGCTTGGTCTAGGGACTTT No data
Right 982529833 4:156525668-156525690 AACACAAGGCTGTTTTTCACAGG No data
982529824_982529833 29 Left 982529824 4:156525616-156525638 CCATTAGAGCATCCCAATGCTTG No data
Right 982529833 4:156525668-156525690 AACACAAGGCTGTTTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982529833 Original CRISPR AACACAAGGCTGTTTTTCAC AGG Intergenic
No off target data available for this crispr