ID: 982531093

View in Genome Browser
Species Human (GRCh38)
Location 4:156544987-156545009
Sequence GGGGATTAGGAAGGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982531093_982531100 21 Left 982531093 4:156544987-156545009 CCTGTGTTTCCTTCCTAATCCCC No data
Right 982531100 4:156545031-156545053 TTTTCCAGAAACTGTTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982531093 Original CRISPR GGGGATTAGGAAGGAAACAC AGG (reversed) Intergenic
No off target data available for this crispr