ID: 982539198

View in Genome Browser
Species Human (GRCh38)
Location 4:156646058-156646080
Sequence ATCCTTAAGGGGATTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982539198_982539204 30 Left 982539198 4:156646058-156646080 CCTTCCAGAATCCCCTTAAGGAT No data
Right 982539204 4:156646111-156646133 TCCATGATGATTTAATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982539198 Original CRISPR ATCCTTAAGGGGATTCTGGA AGG (reversed) Intergenic
No off target data available for this crispr