ID: 982539239

View in Genome Browser
Species Human (GRCh38)
Location 4:156646735-156646757
Sequence TTAAGCACATATGTTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982539237_982539239 -3 Left 982539237 4:156646715-156646737 CCCATCAATAAATTTGTATGTTA No data
Right 982539239 4:156646735-156646757 TTAAGCACATATGTTGAGCTTGG No data
982539238_982539239 -4 Left 982539238 4:156646716-156646738 CCATCAATAAATTTGTATGTTAA No data
Right 982539239 4:156646735-156646757 TTAAGCACATATGTTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982539239 Original CRISPR TTAAGCACATATGTTGAGCT TGG Intergenic
No off target data available for this crispr