ID: 982541971

View in Genome Browser
Species Human (GRCh38)
Location 4:156684186-156684208
Sequence GATACTGACACATTAATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982541966_982541971 9 Left 982541966 4:156684154-156684176 CCCTTTCAAGATAGTTCTGTGCC No data
Right 982541971 4:156684186-156684208 GATACTGACACATTAATGCAGGG No data
982541967_982541971 8 Left 982541967 4:156684155-156684177 CCTTTCAAGATAGTTCTGTGCCC No data
Right 982541971 4:156684186-156684208 GATACTGACACATTAATGCAGGG No data
982541965_982541971 15 Left 982541965 4:156684148-156684170 CCATTTCCCTTTCAAGATAGTTC No data
Right 982541971 4:156684186-156684208 GATACTGACACATTAATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982541971 Original CRISPR GATACTGACACATTAATGCA GGG Intergenic
No off target data available for this crispr