ID: 982546887

View in Genome Browser
Species Human (GRCh38)
Location 4:156745030-156745052
Sequence ACATTAGGACATTATCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982546887_982546891 5 Left 982546887 4:156745030-156745052 CCTCCTTGATAATGTCCTAATGT No data
Right 982546891 4:156745058-156745080 ATAATTCAAGCTGTGGAAAATGG No data
982546887_982546890 -2 Left 982546887 4:156745030-156745052 CCTCCTTGATAATGTCCTAATGT No data
Right 982546890 4:156745051-156745073 GTTGTACATAATTCAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982546887 Original CRISPR ACATTAGGACATTATCAAGG AGG (reversed) Intergenic
No off target data available for this crispr