ID: 982548706

View in Genome Browser
Species Human (GRCh38)
Location 4:156768679-156768701
Sequence ATCCTTCCCCTGCTAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982548702_982548706 -10 Left 982548702 4:156768666-156768688 CCTTCAGATACCTATCCTTCCCC 0: 1
1: 0
2: 2
3: 10
4: 169
Right 982548706 4:156768679-156768701 ATCCTTCCCCTGCTAATGGGTGG No data
982548701_982548706 24 Left 982548701 4:156768632-156768654 CCATCTTGGAAATTCAGACTAAC 0: 1
1: 0
2: 1
3: 12
4: 150
Right 982548706 4:156768679-156768701 ATCCTTCCCCTGCTAATGGGTGG No data
982548700_982548706 25 Left 982548700 4:156768631-156768653 CCCATCTTGGAAATTCAGACTAA 0: 1
1: 0
2: 2
3: 21
4: 220
Right 982548706 4:156768679-156768701 ATCCTTCCCCTGCTAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982548706 Original CRISPR ATCCTTCCCCTGCTAATGGG TGG Intronic
No off target data available for this crispr