ID: 982549544

View in Genome Browser
Species Human (GRCh38)
Location 4:156780604-156780626
Sequence TTGTATGTGCCTTGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982549544 Original CRISPR TTGTATGTGCCTTGAGTGGA AGG Intronic
902145919 1:14398977-14398999 TGGCAAGTGCCATGAGTGGAGGG - Intergenic
902620061 1:17645583-17645605 TTGTAAGTTCCTTGAGAGCAGGG + Intronic
905734859 1:40317692-40317714 TTGTTTGTGCTTGGAGAGGAAGG - Intronic
905876351 1:41434264-41434286 TGGTCTGTGCAGTGAGTGGAGGG - Intergenic
910045085 1:82903731-82903753 TAGAATATGCCTTGACTGGAAGG - Intergenic
913556178 1:119969514-119969536 TTGCATGTGCCCAGAGGGGAAGG - Exonic
915740079 1:158112620-158112642 TTGTGTGTGACTTGGGTGCAAGG - Intergenic
916563480 1:165953408-165953430 ACGTATGTGCCTTGAGAGCATGG + Intergenic
918549843 1:185729731-185729753 CTGTAAGTGCCTTGAGGGCAGGG + Intergenic
1063238687 10:4145889-4145911 ATGTATGGGACTTGAGTTGATGG - Intergenic
1063952434 10:11236391-11236413 TTGAAGCTGCCTGGAGTGGATGG + Intronic
1064938000 10:20701557-20701579 TTGTGTGTGCCTTTAGAGTAAGG - Intergenic
1067414508 10:46093246-46093268 TTGTGTGTGCATTCAGTGGGAGG - Intergenic
1067434570 10:46267788-46267810 TTGTGTGTGCATTCAGTGGGTGG - Intergenic
1069431079 10:68334590-68334612 TTGTCTGAGGCTTGAGGGGAGGG - Intronic
1069482252 10:68794378-68794400 TTGTATATTCATTCAGTGGATGG + Intergenic
1070592353 10:77810185-77810207 TTGTAAGTGCCTTGATGGCAAGG - Intronic
1073011765 10:100365601-100365623 TTGTATGTTCCTGGAGCAGAGGG + Intergenic
1074638210 10:115345316-115345338 TTGTATGTGCCTTCTGTAGGCGG + Intronic
1079320528 11:19448051-19448073 TTGTGTGTCCCTTGAGGGCAGGG - Intronic
1080069939 11:28070450-28070472 TTGTATTTCCCTTGAGGGGAAGG - Intronic
1080297034 11:30742043-30742065 TAGAATGTGGCTTAAGTGGAAGG + Intergenic
1080609247 11:33889633-33889655 TTGTAAGTTCCTTGAATGTAGGG - Intronic
1085249650 11:75134553-75134575 TTGTATGTGCCTTTGATAGAAGG + Intronic
1085874309 11:80387577-80387599 TTGTCTCTGCATTGAGTGGAAGG - Intergenic
1086380609 11:86248639-86248661 TTTTTTTTCCCTTGAGTGGAAGG + Intronic
1086962598 11:92994732-92994754 ATGTATGTTCATTGAGTAGATGG + Intergenic
1087720658 11:101661791-101661813 TTGTATGTCTTTTGATTGGAAGG + Intronic
1089863942 11:121615553-121615575 TTGTAAGTTCCTTGAAGGGAAGG + Intronic
1093340765 12:17970769-17970791 TTTTATGTTCATTGACTGGAAGG - Intergenic
1093888519 12:24491135-24491157 TTGTGTGTGCTTGGAGTGAAGGG + Intergenic
1093994272 12:25624849-25624871 TTGTATTTGCCTTTAGAGGGAGG - Intronic
1094276881 12:28687149-28687171 TTGTAAGTGCCCTGAGAGCAAGG + Intergenic
1096719661 12:53511747-53511769 TAGTATGTGCTTTATGTGGATGG - Intronic
1096753027 12:53774919-53774941 ATGTAAGTGACTTGAGTGGAGGG + Intergenic
1096877474 12:54641447-54641469 CTGTCTCTGCCTTGAGCGGATGG + Intergenic
1097191887 12:57223361-57223383 GTGTATGTGCCTGGATTGGCTGG - Intronic
1097811371 12:64022858-64022880 ATGTAAATGCCTTGAGAGGAAGG - Intronic
1099351866 12:81581325-81581347 TTTTCTCTGCCTTGAGTAGAGGG + Intronic
1100177926 12:92051836-92051858 TTGCAGGGGGCTTGAGTGGATGG - Intronic
1100223948 12:92537654-92537676 TTGTATCTGCCTTGAGTGCCAGG - Intergenic
1101983194 12:109425514-109425536 TTGTAAGTCCCTTGAGGGCAGGG - Intronic
1102066626 12:109981910-109981932 TTGTGAGTGCCTTGAATGGTGGG - Intronic
1102654844 12:114473384-114473406 TTTCATGTGTCTTGAATGGAAGG - Intergenic
1106285225 13:28312822-28312844 TGCTGTGTGCCTTGAGTGGTGGG - Intronic
1107204419 13:37765037-37765059 TAGTATGTTCCTTGAATGGTAGG + Intronic
1108265837 13:48707786-48707808 TTGTCTTTGCCTTCTGTGGATGG - Exonic
1109650274 13:65314507-65314529 TTCTATGTGACTTTAGTTGATGG - Intergenic
1110715387 13:78697282-78697304 TTTTATGTGTGTTGGGTGGAGGG + Intergenic
1112702041 13:102021072-102021094 GTGTATGTGCCTTAAGTGGAGGG + Intronic
1117541636 14:56752629-56752651 TTGTCTGGGCCCTGGGTGGAGGG - Intergenic
1117785029 14:59274586-59274608 ATGTTTGTGGCTTGAGTGAATGG + Intronic
1118878997 14:69810345-69810367 ATGAATGTGCCTTGGTTGGAAGG + Intergenic
1119521149 14:75286456-75286478 TTCTATGTGCCAGGAGTGGAAGG - Intergenic
1124346437 15:28924646-28924668 TTGTTTGTGCCTTCATTTGATGG + Intronic
1127077624 15:55343437-55343459 TTTTGTGTGCCTGGAGGGGACGG + Intronic
1127358378 15:58223674-58223696 GTGTATGTGTATTGAGGGGAGGG - Intronic
1127747640 15:61996318-61996340 TTGTGTTTGCCTTCTGTGGATGG - Intronic
1128791685 15:70439005-70439027 TTGGCGGTTCCTTGAGTGGAGGG + Intergenic
1129352363 15:74963693-74963715 TTGCATTTGCCTGGTGTGGAAGG + Intronic
1131445397 15:92494612-92494634 TTGTTTGTTGCTTGATTGGAAGG + Intronic
1132089857 15:98939452-98939474 TAGTGTGTCCCTTGAGTGCACGG + Intronic
1132489282 16:216825-216847 TGGCATGTGCCTTGAGAGAATGG - Intronic
1138945818 16:61848490-61848512 TTCTATGTGCTTGGAGTGGGGGG + Intronic
1139232153 16:65294205-65294227 TTGTCTGTGCCTTCAGTAGAGGG + Intergenic
1141001105 16:80309020-80309042 TGGTATGTGTATTGGGTGGAGGG - Intergenic
1141340858 16:83202510-83202532 TTGCATGTGCCTTCATTGGAAGG - Intronic
1141848474 16:86627502-86627524 TTCTAGGTGCCTGGAGTGGCTGG + Intergenic
1143347613 17:6261470-6261492 TTTTATGTGCCTTGAGAATAAGG - Intergenic
1144026129 17:11277426-11277448 CTGTAAGTGCCTTGAGTACAGGG + Intronic
1145065439 17:19758431-19758453 TTGTATGTGATTTTTGTGGATGG - Intergenic
1149051198 17:52307392-52307414 TTGTACATGCCTTGAGTATATGG - Intergenic
1149957132 17:61064092-61064114 TTGCAAGTGCTTTGAGAGGATGG + Intronic
1152991691 18:369167-369189 TGGTATGTGCATTGAGTGGTAGG - Intronic
1155334125 18:24747824-24747846 TTCTATGGGACTTGAGAGGAAGG - Intergenic
1157754896 18:50209108-50209130 CTGTATTTGAGTTGAGTGGAAGG - Intergenic
1157846654 18:51009694-51009716 TTGTAAGTTCCTTGAGGGCAAGG - Intronic
1160441542 18:78896506-78896528 ATGTATGTGGCCTGGGTGGATGG - Intergenic
1160785951 19:900396-900418 TTGTGTGGGCCTGGAGTGGGTGG - Intronic
1160800635 19:966501-966523 ATGTTCCTGCCTTGAGTGGAAGG + Intronic
1164694136 19:30230907-30230929 TTTAAAGTGCCTTGAATGGAGGG + Intronic
1167708267 19:51094629-51094651 TTGTATCTCCCTTGAGGGCATGG + Intergenic
926093616 2:10066106-10066128 TTGCCTGTGCAATGAGTGGATGG - Intronic
926545128 2:14230567-14230589 TTGTATGTGGCTATAGTGAATGG + Intergenic
926772155 2:16387918-16387940 ATCTAAGTGCCTTTAGTGGAAGG - Intergenic
926843686 2:17110012-17110034 TTCTATGTGACTTGACTGTAGGG - Intergenic
926912498 2:17864214-17864236 TTACAGGTGCCTTGAGTGAAAGG + Intergenic
928483865 2:31710092-31710114 TTTTATCTGTCTTCAGTGGAAGG - Intergenic
928743720 2:34386977-34386999 TTGGATGTGCCCTCAGTGCATGG - Intergenic
930274145 2:49292183-49292205 ATGTATGAGCCTTGAGTTCATGG - Intergenic
930562521 2:52978235-52978257 TTTAAAGTACCTTGAGTGGAAGG - Intergenic
932693241 2:73931471-73931493 TTGGATGTGCCTGGAGTTGAAGG + Intronic
933498305 2:83079387-83079409 TTGTATGTGTTTTGTGGGGACGG + Intergenic
937465891 2:122132729-122132751 TTGAGTGTGCTTTAAGTGGAAGG + Intergenic
940347812 2:152645743-152645765 TTGTATTTGCTTTGAGTGTTGGG + Intronic
940959617 2:159769791-159769813 TTGTATGGGAGTTGAGTGGAAGG + Exonic
942536479 2:176969862-176969884 TTGGATGTGCCTTAAGGGCAAGG - Intergenic
944382774 2:199130819-199130841 GTGTCTGTCTCTTGAGTGGATGG + Intergenic
946654083 2:221926289-221926311 CTTTATGTGTATTGAGTGGAGGG + Intergenic
948336525 2:237211826-237211848 ATGTATGTGGCTTGCGTGTAAGG + Intergenic
1168848069 20:958869-958891 TTGTATTTGCCGTGACTGGTTGG - Exonic
1169047556 20:2546610-2546632 GTGTATGTCTCTTGAGTTGAAGG + Intronic
1169726215 20:8735809-8735831 TTCTATTTGGCTTGAGTGCATGG - Intronic
1170506772 20:17034742-17034764 TTGTCTGGGCCTTTGGTGGATGG - Intergenic
1170614623 20:17938770-17938792 GTGTATGTGCGAGGAGTGGATGG + Intergenic
1172612784 20:36264203-36264225 TTGTAGGGGCCTTTAGTGCAAGG - Intronic
1173497395 20:43529455-43529477 TTGTGTGTGCTCTGAGGGGAGGG - Intronic
1174588402 20:51626105-51626127 TTGTGTGTTCCCTGAGGGGAGGG - Intronic
1178096098 21:29217393-29217415 TTCTATCTACCTTGAGAGGAAGG - Intronic
1179039518 21:37789878-37789900 TAGTCTGTGGTTTGAGTGGAAGG + Intronic
1179126075 21:38591843-38591865 TTGTAAATGCCTTGAGGGCAGGG - Intronic
1181041092 22:20192975-20192997 GTGTATATGCCTTGAGGGGGAGG - Intergenic
1181994821 22:26869033-26869055 TTGTATCTGACTTAAGTGTAAGG - Intergenic
1183866723 22:40710195-40710217 CTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1184811767 22:46839915-46839937 TTGTATATGCCGTGAGTTAAGGG - Intronic
1185004048 22:48265006-48265028 TTGTGTGTGCGTTGTGTGTATGG - Intergenic
1185155762 22:49192516-49192538 TTGTCTTTGCGTTGAGTGGAGGG + Intergenic
950769138 3:15297144-15297166 TGGCATGGGCCTTGAATGGATGG - Intronic
951635600 3:24772132-24772154 TTGTCTGCGCCTGGAGTAGATGG + Intergenic
952193538 3:31048431-31048453 TGGTGTGTGCATGGAGTGGAAGG + Intergenic
954701482 3:52453054-52453076 TTGTATGGGCACTGGGTGGAGGG + Intronic
958893034 3:99801442-99801464 GTGTATGTGTCTTGAGTGGCAGG + Intergenic
961236920 3:125375159-125375181 TTCTAGGGGCCTTGAGAGGAGGG + Exonic
961838419 3:129684946-129684968 TTGTGTGTTCCTTGAGAGCAGGG - Intronic
962741206 3:138363692-138363714 ATGTGTGTGTCTTGAGAGGAGGG + Intronic
962976656 3:140451767-140451789 TTCTGTGTGTCTTCAGTGGATGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966888866 3:184391798-184391820 TTGAATGGGCATTGAATGGATGG - Intronic
971683138 4:29727752-29727774 TTGTGTGTGCTTTGTGTGTAAGG - Intergenic
979079770 4:116321658-116321680 TTATTTGTGGCTTGTGTGGAGGG - Intergenic
980511747 4:133799838-133799860 GTGTATCTGCCTTGAAAGGATGG + Intergenic
982549544 4:156780604-156780626 TTGTATGTGCCTTGAGTGGAAGG + Intronic
989483388 5:41959554-41959576 TTGCATGTGCTTTGAGACGATGG + Intergenic
989714536 5:44445981-44446003 TTGTATGTGCTTGGAGTAGTTGG + Intergenic
990283923 5:54280588-54280610 TTGTAAGTTCCTTGAGGGCAGGG - Intronic
991917624 5:71620746-71620768 TTGCCTGTGCCTTCTGTGGAGGG + Intronic
992217327 5:74538890-74538912 TTGTAAGTTCCTTGAGGGCAGGG - Intergenic
992677033 5:79115540-79115562 TTGTATGTGCTGTGGGTGGGGGG - Intronic
992871152 5:81006936-81006958 TTGTATGTTCCTCGAGTCCATGG + Intronic
993426577 5:87772340-87772362 TTAGATGTGGCTTAAGTGGAAGG + Intergenic
995030482 5:107474898-107474920 TTGTATAGGCCTTGAATGGTAGG - Intronic
996007799 5:118443913-118443935 CTTTATGGGCCTTAAGTGGATGG + Intergenic
1000799235 5:165703870-165703892 GTGTATGTGTGTTGGGTGGAAGG + Intergenic
1006415473 6:33901190-33901212 GTGGATGTGCCATGAGTGTAAGG - Intergenic
1008413642 6:51213989-51214011 ATGAATGTGCCCGGAGTGGATGG + Intergenic
1011740059 6:90350521-90350543 TTGTAAGTTCCTTGAGGGCAGGG + Intergenic
1012548906 6:100450062-100450084 TTGTTTGGGCCTAGGGTGGAAGG + Intronic
1014087383 6:117363142-117363164 TTGTCTGTGCCTTGTGTAGATGG + Intronic
1015668292 6:135657193-135657215 TTGAATGTGCCTTAAGTTTAAGG + Intergenic
1015793560 6:136988333-136988355 TTGTAAGTTCCTTGAGGGCAGGG + Intergenic
1017792801 6:157816133-157816155 TTGTGTGTTCATTGACTGGAGGG - Intronic
1022324360 7:29317703-29317725 TTATATGTTCCCTGAGTGCAGGG - Intronic
1026399043 7:69990296-69990318 TTGTATGTGCCCAGAGGGAAGGG + Intronic
1028471436 7:91211013-91211035 TTGTATTTGTATTCAGTGGAGGG - Intergenic
1029345588 7:99976255-99976277 TTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1029346198 7:99980520-99980542 TTGTGTGTGCCTGGGGCGGAAGG - Intergenic
1029558979 7:101289995-101290017 TTGTGTGTGCCTGGGGCGGAAGG + Intergenic
1030204190 7:106936845-106936867 TTTTATGTGCCTTAAATTGAAGG + Intergenic
1030757977 7:113313039-113313061 TTTTATGTGCCTTGCCTTGAAGG - Intergenic
1035055183 7:156030494-156030516 TTTTATCTGCCTTGAGAGAAGGG + Intergenic
1036498602 8:9293545-9293567 ATGCAAGTGCCTTGAGAGGAGGG - Intergenic
1036922033 8:12865629-12865651 TTCTAGGTGCTTTTAGTGGAAGG - Intergenic
1038777599 8:30544950-30544972 ACGTGTGTGCCTTGTGTGGAAGG + Intronic
1039064669 8:33598395-33598417 CTGTGTGTGTCTTGAGGGGAGGG + Intronic
1039064684 8:33598467-33598489 CTGTGTGTGTCTTGAGGGGAGGG + Intronic
1042667269 8:71220945-71220967 ATGTAAGTGCCTTGAGGGCAAGG - Intronic
1043047086 8:75339758-75339780 TTTCATGTGCCTGGAGTAGAAGG - Intergenic
1045961137 8:107970009-107970031 TTGGATGGGGGTTGAGTGGAGGG - Intronic
1047280561 8:123441767-123441789 TTGTAAGTTCCTTGAGGGCAGGG + Exonic
1047822683 8:128538792-128538814 TTGTACTTGCCTTCAGTGAATGG - Intergenic
1055568274 9:77590664-77590686 TTGTTTGTCCCATGAGTGAACGG - Intronic
1055882641 9:81020070-81020092 CTGTGAGTTCCTTGAGTGGAGGG + Intergenic
1056407426 9:86288112-86288134 TTATGTGGGCCTTCAGTGGATGG - Exonic
1056601991 9:88053717-88053739 GTCTATGTGCCCTGGGTGGAGGG + Intergenic
1058383436 9:104405642-104405664 TTATTTGTTCCTTGAATGGATGG + Intergenic
1058861861 9:109124409-109124431 TGGTATGTGCGTTGTGTGTAAGG + Intergenic
1062553238 9:137100053-137100075 CTGTGTGTGCCTTGGGTGGCTGG - Intronic
1187091372 X:16100407-16100429 CTGTATGTGCGTTGGGGGGAGGG + Intergenic
1190109062 X:47578261-47578283 TTGTGTGTCTCTTGATTGGACGG - Intronic
1193374017 X:80736060-80736082 CTGTTTGTGCCTTTAGTTGATGG + Exonic
1195334468 X:103836880-103836902 TTGTATGTGCTGTGAGGTGAGGG - Intergenic
1195718869 X:107846445-107846467 TTTTATGAGCATTGAGTTGAAGG - Intronic
1195896903 X:109754606-109754628 CTGTATGTGTTTTGACTGGAGGG - Intergenic
1196254317 X:113497980-113498002 TTGTATGTGTGGTGAGAGGAGGG + Intergenic
1199739423 X:150719219-150719241 TTGATTGTGCCATGGGTGGATGG + Intronic
1200985521 Y:9299598-9299620 ATGTCAGTGCCTTGAATGGATGG + Intergenic
1202117075 Y:21479339-21479361 ATGTCTGTGCCTTGAAGGGATGG - Intergenic