ID: 982550162

View in Genome Browser
Species Human (GRCh38)
Location 4:156787712-156787734
Sequence GAGATGAATGAGATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 362}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982550162 Original CRISPR GAGATGAATGAGATGGAGTA AGG Intronic
900791519 1:4684002-4684024 GGGAGGAAGGAGATGGAGGAAGG + Intronic
901735353 1:11308881-11308903 GAGATGATTGATAATGAGTAGGG + Intergenic
902205261 1:14863795-14863817 AGGATGAATGAGTCGGAGTAGGG + Intronic
902386253 1:16077666-16077688 GACATGAATGAGACGGACAAGGG + Intergenic
902532077 1:17097047-17097069 GAGACGGATGAGGTCGAGTAGGG + Intronic
902618500 1:17636978-17637000 GTGATGATACAGATGGAGTAAGG - Intronic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
904855066 1:33491564-33491586 GAGATGGATGAGCAGGAGGAAGG + Exonic
904873214 1:33634818-33634840 GAGAGGAATGGGATGGAGCTGGG - Intronic
905514025 1:38548060-38548082 TAGATGAAGGAGATGCAGCAGGG + Intergenic
905979160 1:42207969-42207991 GAGATGACTGAGTTGAATTAAGG - Intronic
906779851 1:48563481-48563503 GAGATGACAGAAATGGAGTGAGG + Intronic
907650731 1:56292307-56292329 GAGAAAAATGAGGTGGAGAAGGG - Intergenic
908235902 1:62147160-62147182 GAGATGGATGGGATGGGATATGG + Intronic
909142345 1:71884145-71884167 GTTAGGAAAGAGATGGAGTAAGG - Intronic
910739569 1:90500337-90500359 GGGATGAGTGAGAGGTAGTAAGG - Intergenic
911827731 1:102508675-102508697 GAGATGAATCAGATTGGGTCAGG + Intergenic
912422148 1:109550021-109550043 GAGAAGAATAAGTAGGAGTAGGG + Intronic
912631718 1:111252220-111252242 GAGATGAAGGTGAGGGAGAATGG + Intergenic
912938415 1:114023888-114023910 GAGAGTAATGAGATAGAGTGGGG + Intergenic
913100458 1:115559348-115559370 GAGAAGAAAGAGATGGAGATTGG - Intergenic
915154612 1:153864643-153864665 GAGATGAAAGAGAGGGAGGGAGG + Intronic
915231609 1:154449776-154449798 GTTATGAATGAAATGGAGAAAGG + Intronic
915334539 1:155133392-155133414 GAGAAGAATGAAATTGAGTAGGG + Intronic
915562385 1:156694739-156694761 GATGGGAATGAGATGGAGCAAGG + Intergenic
916055668 1:161067691-161067713 GAGAGGGCTGAGATGGAGCAAGG + Intronic
916181629 1:162088960-162088982 GAGATGAAGGGGAAGGAGAATGG - Intronic
917921998 1:179758453-179758475 GAGAGAAAGGTGATGGAGTAGGG - Intronic
919166769 1:193905510-193905532 GAGATGACTGAGAAGCAGGATGG + Intergenic
919737748 1:200963873-200963895 GAGATGCAGGAGATGGGGTTTGG + Intergenic
920816150 1:209334063-209334085 GAGATGAATTAGCAGGAATAAGG + Intergenic
921262099 1:213393746-213393768 GGAATGAATGGGATTGAGTAAGG + Intergenic
921452194 1:215322462-215322484 GAGAAGAATGAGATAGACCATGG - Intergenic
1063354738 10:5387540-5387562 GAGATGAAAGAGAGAGGGTATGG - Intergenic
1063382090 10:5591822-5591844 GAGATGAGTGAGCCGGAGCAGGG + Intergenic
1064142355 10:12801111-12801133 GAGAAGGAGGAGATGGAGTTGGG + Intronic
1064235178 10:13567322-13567344 GAGCTGAAAGAGATGGTGGAAGG - Intergenic
1064266765 10:13831636-13831658 GAGTTAAATAAGATGGTGTATGG + Intronic
1064303205 10:14141093-14141115 GAGAAGCAGGAGATGGAGAATGG + Intronic
1064715583 10:18173258-18173280 GAGATGATGGAGATGAAATAAGG + Intronic
1064753322 10:18553885-18553907 GAGTGGAATGAGATGGAGAATGG + Intronic
1064754085 10:18559127-18559149 GAGTGGAATGAAATGGAGAATGG + Intronic
1064754979 10:18565432-18565454 GAGTGGAATGAAATGGAGAATGG - Intronic
1064755523 10:18569212-18569234 GAGTGGAATGAAATGGAGAATGG - Intronic
1064755994 10:18572280-18572302 GAGTGGAATGAAATGGAGAATGG - Intronic
1064828412 10:19432573-19432595 GAAATGAATGAAGTGGAGAAAGG + Intronic
1067936096 10:50613376-50613398 GAGATGAGTGCGATGGGGTCTGG - Intronic
1068342166 10:55719248-55719270 GAGTGGAATAATATGGAGTAAGG - Intergenic
1069245719 10:66202759-66202781 GAGAGGAAAGAGAAGTAGTATGG - Intronic
1069250709 10:66262907-66262929 GAGATGACTGAAGTGGAGGAAGG + Intronic
1069884808 10:71616912-71616934 CAGATGGATGAGATGGGGTAGGG - Intronic
1071052334 10:81466227-81466249 GAGAAGAATGAAATGAAGTTCGG + Intergenic
1071368222 10:84923282-84923304 GATAGGAATGAGTTGAAGTATGG + Intergenic
1072626913 10:97118456-97118478 GAGATGCATGGGCTGGAGTCTGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073945311 10:108743412-108743434 GAGTTGGATGTGATGGAATAGGG - Intergenic
1074318561 10:112380409-112380431 AGGATGAATGAGATGGTGTGTGG - Intronic
1075055648 10:119216505-119216527 GAGATGAAAGAAAGGGAGTCAGG + Intronic
1075189996 10:120298470-120298492 GGGAAGCATGTGATGGAGTAAGG - Intergenic
1076264991 10:129102834-129102856 TAGAAAAATGAAATGGAGTAAGG + Intergenic
1077346417 11:2058693-2058715 GAGATGAAAAAAATGGAGAATGG - Intergenic
1077736764 11:4799885-4799907 TAAATGAAGGACATGGAGTAAGG - Intronic
1077836687 11:5932646-5932668 GAGATGAAATAGCTGGAGTCTGG - Intronic
1077900080 11:6480947-6480969 GAGGTGTATGAGACGGAGGAGGG - Intronic
1078096306 11:8299374-8299396 GAGAAGGATGGGATGGAGTTAGG - Intergenic
1078633021 11:13021739-13021761 CAGATAAATGAAATGGAGAATGG - Intergenic
1080037677 11:27726164-27726186 GAGATGAATAAGAGGAAGTATGG + Intergenic
1080825205 11:35842538-35842560 GAGATAAATGAGAAGGAGAGAGG + Intergenic
1081113693 11:39171039-39171061 GAGGTGACTGAGAAGGAGAATGG + Intergenic
1081829518 11:46096380-46096402 GAGAGGAATTAGAGGGAGTATGG - Intronic
1086591998 11:88525559-88525581 TAGATGAATGTGATGGCATATGG + Intronic
1086989852 11:93291003-93291025 GACAGGAATGAGATGGAGGATGG + Intergenic
1087246941 11:95850521-95850543 GAGATTAATGAGTAGGAGAATGG - Intronic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1088940291 11:114447254-114447276 GAGAAGAATGAACTGGAGAAAGG + Intronic
1089195502 11:116692087-116692109 GAAAAGGATGAGATGGAGTCAGG - Intergenic
1089325420 11:117653441-117653463 GTGATGAATGAGCTGGGGGAAGG - Intronic
1089603308 11:119627870-119627892 GAGGTGGTTGAGATGTAGTAGGG + Intronic
1089685987 11:120147152-120147174 GAGAGGAATGGGAGGGAGGAAGG + Intronic
1089950054 11:122517304-122517326 GATATGCATGAGATAGATTATGG + Intergenic
1090075235 11:123576411-123576433 GAAAGGAAAGAGATGGAGAAAGG - Intronic
1090885938 11:130876852-130876874 GAGATGAATGAGATGTCTCATGG - Exonic
1092785068 12:12019084-12019106 CAGAGGAATGAGATCGAGTTTGG - Intergenic
1092974319 12:13729669-13729691 TAGCTGAAAGAGATGGAGAATGG + Intronic
1095874741 12:47068399-47068421 GAGATGAATGTGATGGAGATGGG + Intergenic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1097576748 12:61403337-61403359 GAGAAGAATGAGATGGTACATGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1099161567 12:79248252-79248274 GAGATGAATGAGATGGATAAAGG + Intronic
1099657115 12:85507687-85507709 CAGTTGGTTGAGATGGAGTAAGG + Intergenic
1100549200 12:95631043-95631065 GAGAAGAGAGAGAGGGAGTAGGG + Intergenic
1100574211 12:95874495-95874517 GAGAAGAATGAGATGAATGAAGG + Intronic
1101141453 12:101800098-101800120 GAGATTAATGAGAAGCAGAATGG + Intronic
1104036900 12:125104038-125104060 GAGATTAAGGAAATGGATTATGG + Intronic
1105493693 13:20911634-20911656 GAGATAAATGAAATCGAGAATGG + Intergenic
1106863179 13:33933927-33933949 GAGATGAATGGTATGGGGGAGGG + Intronic
1107567756 13:41623474-41623496 GGGATGAATGAGAGGCAGCAGGG + Intronic
1107733353 13:43370544-43370566 GAAATGAGTGAGAGGGAGCAGGG - Intronic
1108147867 13:47498653-47498675 GAGAGGAGAGAGCTGGAGTAGGG + Intergenic
1108560467 13:51638256-51638278 GAGAAGGATGAAAAGGAGTAAGG + Intronic
1108568846 13:51729520-51729542 GAGAAGAATGGGCTGGAGGAAGG - Intronic
1110310558 13:74044414-74044436 GAGATATATAAGATGGTGTATGG + Intronic
1110612076 13:77500048-77500070 GAGATGAAAGATCTGGAGAATGG + Intergenic
1110674670 13:78226944-78226966 GAGATGAATGAGAAGGACATAGG - Intergenic
1111930285 13:94505631-94505653 GAGTTGAAAGAGAGTGAGTATGG + Intergenic
1112795616 13:103053864-103053886 AAGATAAATGAGGGGGAGTAAGG + Intronic
1118066156 14:62193037-62193059 GAGATGCATGTGTGGGAGTAGGG - Intergenic
1118979168 14:70702048-70702070 GAGAGGAATGAGCTGGAGATGGG - Intergenic
1119013071 14:71017288-71017310 CAGATGAATGAAATGGAGAAAGG + Intronic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121045461 14:90784575-90784597 GAGATGGATGAGATGGAGATGGG + Intronic
1121121746 14:91380091-91380113 GAAATGAATGAGGTGGGGGAGGG - Intronic
1121888679 14:97568778-97568800 GAGTTGGATGAAATGGAATAGGG - Intergenic
1122016549 14:98801746-98801768 CAGATGAATAAGATTGAGTTTGG + Intergenic
1124149537 15:27165194-27165216 GATATGAGGCAGATGGAGTAGGG + Intronic
1126314594 15:47356782-47356804 GAGATGGATGAAATGGTGGATGG - Intronic
1128285884 15:66436735-66436757 CAGATGAATTAGCTGGAGAAAGG - Exonic
1128673881 15:69594911-69594933 GAAATGAATGGGAAGGAGGAGGG + Intergenic
1129618815 15:77123909-77123931 GATATGGATGAGATGGAAAATGG + Intronic
1130333378 15:82938522-82938544 GAGAAGGATGAGAGGCAGTAAGG - Intronic
1132183420 15:99780429-99780451 GAGATGGAGGAGAGGGAGGAGGG + Intergenic
1132435015 15:101793052-101793074 GAGATGGAGGAGAGGGAGGAGGG - Intergenic
1134504366 16:14792980-14793002 GGGAGGAATGAGAAGCAGTAGGG - Intronic
1134576207 16:15335929-15335951 GGGAGGAATGAGAAGCAGTAGGG + Intergenic
1134726236 16:16420573-16420595 GGGAGGAATGAGAAGCAGTAGGG - Intergenic
1134941196 16:18291287-18291309 GGGAGGAATGAGAAGCAGTAGGG + Intergenic
1135153580 16:20032192-20032214 AAGATGAAGAAGATGGAGCAGGG + Exonic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135248159 16:20875504-20875526 GAGAAGACTGAGATGGAATATGG - Intronic
1135781488 16:25305949-25305971 ATGATGAAGGAGATAGAGTATGG + Intergenic
1137373429 16:47929863-47929885 GAGATAAATGGGATGAAGCATGG + Intergenic
1137814425 16:51384956-51384978 GAGAAGACTGAGATGCAGAAGGG + Intergenic
1138663367 16:58540651-58540673 TCTATGAATTAGATGGAGTAAGG + Intronic
1138852015 16:60641009-60641031 GAGATGTAGGAGATGGAGATAGG + Intergenic
1139178901 16:64722586-64722608 CAAATGAAGGAGATAGAGTAAGG + Intergenic
1140194909 16:72847921-72847943 GAATGGAATGAGATGGAGGAGGG - Intronic
1140407607 16:74721486-74721508 CAGGTGAGGGAGATGGAGTAAGG - Intronic
1140466436 16:75186836-75186858 GGGAGAAATGAGATGGAGGAAGG + Intergenic
1141021093 16:80497172-80497194 TAGATGAAAGAGATGGCATAGGG - Intergenic
1142642092 17:1290041-1290063 GTGAAAGATGAGATGGAGTATGG - Intronic
1142706392 17:1697683-1697705 GAGATGGAGGAGATGGGGGAGGG - Intergenic
1142928351 17:3260478-3260500 GAGAGGAATGAGAGGAAGGAAGG - Intergenic
1143098755 17:4493158-4493180 GAGATGAATCAGAAAGGGTACGG + Intergenic
1144944034 17:18960722-18960744 GAGATGAATGAGAAGATGTCAGG - Intronic
1145752994 17:27368513-27368535 GAGATGAAGGACATGAAGGAGGG - Intergenic
1147243564 17:39106227-39106249 GAGATGCATTAGATGGGGAAGGG - Intronic
1148020851 17:44552511-44552533 GGGGTGAAATAGATGGAGTAGGG - Intergenic
1149391390 17:56194941-56194963 GAGATGAATGATAGGAAGGAGGG - Intronic
1149957530 17:61069314-61069336 ATGATGAATGTGATGGAGAATGG + Intronic
1150557178 17:66264834-66264856 GAGAAGAATGAGAATGAGTGGGG - Intergenic
1151798816 17:76365247-76365269 GAGCTAAATGAGATGGAGAGTGG + Intronic
1152435443 17:80273546-80273568 GAGATGAATCAGGTGCAGAAGGG - Intronic
1153225257 18:2895011-2895033 GAGATGAATGAGATTGTTTGTGG + Intronic
1154176671 18:12090561-12090583 GTGATGCATGCGATGGAGTCTGG + Intergenic
1155890062 18:31256654-31256676 GAGAAGAAAGAGAAGAAGTAGGG + Intergenic
1156445262 18:37231875-37231897 GAGATGAGGGAGCTGGAGGAGGG + Intronic
1157442838 18:47723483-47723505 GGGCTGAGTGAGATGGAGTGAGG - Intergenic
1157970470 18:52261854-52261876 CAGATGAATAATATGGAATATGG + Intergenic
1158841369 18:61391905-61391927 GTAATGAAGGAGATGGAGGAAGG - Intronic
1159971193 18:74656578-74656600 GAGATGTATGAGATGCCCTAGGG + Intronic
1160347871 18:78149719-78149741 GAGATGAATAAGCTTGAGGAAGG - Intergenic
1160374531 18:78401452-78401474 GAGATGAAGAAGATGGAGCCTGG + Intergenic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1163082986 19:14956834-14956856 GGGAAGACTGGGATGGAGTAGGG - Intronic
1163297894 19:16424213-16424235 GAGATGAGGAAGTTGGAGTAGGG + Intronic
1165759159 19:38310435-38310457 TAGATGAATGAGTTGGTGGATGG - Intronic
1165788746 19:38478147-38478169 GAGATGACAGAGAAGGAGAAGGG - Intronic
1166375518 19:42324954-42324976 GAGATGCGGCAGATGGAGTACGG - Exonic
1166414565 19:42584853-42584875 GATATAAATGAAATGGAGAATGG + Intronic
1168433585 19:56300966-56300988 GAGATGGATGAGAAAGAGAAAGG + Intronic
925334987 2:3090514-3090536 GAGATAAATGAAATAGAGAATGG + Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
928136375 2:28690824-28690846 GAGATGAATAAGATGCTGTTAGG - Intergenic
929664121 2:43820600-43820622 GACAAGAATGGAATGGAGTAGGG - Intronic
931675901 2:64695924-64695946 AAGATGCATGAGATGAAGTTTGG - Intronic
931902782 2:66807608-66807630 GAGATGGATGAGGGGGAGGAGGG + Intergenic
932128428 2:69166405-69166427 GGGAAAAATGAGATGGAATATGG - Intronic
932796342 2:74699349-74699371 GAGGTGACTCAGATGGATTATGG - Intergenic
933677903 2:85074192-85074214 GAGATAAATGAAATCGAGAATGG - Intergenic
934662808 2:96152328-96152350 GAGGGGCATGAGATGGAGCAGGG + Intergenic
934902983 2:98175856-98175878 GGAATGAAGGAGATGGAGGATGG - Intronic
935355765 2:102198196-102198218 GGAATGAATGAGCTGGAATAGGG + Intronic
936708227 2:115101135-115101157 GTGATGGATGACATGGAGTCTGG + Intronic
937714501 2:125015970-125015992 GAGATGAAAGAAAAGGAATAAGG - Intergenic
938138160 2:128775880-128775902 GTGATCAATGAGCTGGAGTGAGG + Intergenic
939328265 2:140723589-140723611 GAGAAGAGTGAGATGAACTAAGG + Intronic
939443398 2:142277596-142277618 GAGAAGAAAGAGATGGAGATGGG - Intergenic
939771593 2:146326719-146326741 GAGAGGAAAGACATGGAGGAGGG + Intergenic
939837946 2:147152201-147152223 GAAATGAATGAAATGAAGAAGGG + Intergenic
940287467 2:152046954-152046976 AACATTATTGAGATGGAGTAGGG + Intronic
940580104 2:155568572-155568594 CAGATGTATGAGATGGTATAAGG - Intergenic
941704594 2:168644472-168644494 CAGATGATTGAGCTGGAGAAAGG + Intronic
942783670 2:179675607-179675629 GAGAGGAAACAGGTGGAGTAAGG + Intronic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
945778232 2:214133806-214133828 GAAAGGAAAGAGATGGAGAATGG + Intronic
945898058 2:215506720-215506742 GAGATGAAAGAGAGAGAGTGTGG + Intergenic
947339361 2:229121207-229121229 GAGATGAATGTGCAGGTGTATGG - Intronic
947842937 2:233220214-233220236 TACATGAATGAGAGTGAGTAGGG + Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168833128 20:858299-858321 GAGATGAAGGAGTTGGACTGGGG + Intergenic
1168908880 20:1429212-1429234 GAGATGCATAGGATGGAGTTGGG + Intergenic
1170428788 20:16259231-16259253 TACATGTTTGAGATGGAGTAAGG - Intergenic
1172358020 20:34293109-34293131 AGGAAGAATGAGATGGGGTATGG - Intronic
1172613159 20:36266527-36266549 GAGAAGAATGAGCGGGAGGATGG + Intronic
1173159173 20:40639606-40639628 CAGATGAATGAGATGGTAGATGG - Intergenic
1173562143 20:44013502-44013524 GAAATGAATGGGTTGGACTAGGG - Intronic
1173577188 20:44120082-44120104 GAGAAGAATGAGAGGCAGGATGG - Intronic
1174653004 20:52144614-52144636 GAAATGAATGAAATGGAGGAGGG + Intronic
1174863502 20:54114294-54114316 GTGAGGAATGGGCTGGAGTAGGG + Intergenic
1175345074 20:58267055-58267077 GAGAAGAATGGGATGGAGGAGGG + Intergenic
1175710514 20:61216866-61216888 GAAATGAATGAGATGGGATGTGG + Intergenic
1176752320 21:10700772-10700794 GAGAGGAATGCAATGGAATAGGG - Intergenic
1177048470 21:16201368-16201390 GAGATGGATGAGATGAACAAAGG - Intergenic
1177254382 21:18641575-18641597 GAAATGAATGAGAGGTAATAAGG - Intergenic
1177873912 21:26607970-26607992 GAGATGAATGAATTGGAGGTAGG + Intergenic
1179478323 21:41662036-41662058 GATGTGAATGGAATGGAGTATGG - Intergenic
1180798377 22:18619238-18619260 GAGCTGAAGGAGAGGGAGTGAGG + Intergenic
1180836246 22:18930984-18931006 GAGCACAAGGAGATGGAGTAAGG - Exonic
1181223341 22:21376027-21376049 GAGCTGAAGGAGAGGGAGTGAGG - Intergenic
1181255399 22:21559599-21559621 GAGCTGAAGGAGAGGGAGTGAGG + Intronic
1181411041 22:22719951-22719973 GAGAAGGAGGAGATGGAGCAGGG + Intergenic
1181412983 22:22737988-22738010 GAGAAGGAGGAGATGGAGGATGG + Intronic
1182266518 22:29120071-29120093 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266524 22:29120098-29120120 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266537 22:29120154-29120176 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266550 22:29120210-29120232 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266563 22:29120266-29120288 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266583 22:29120351-29120373 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182509839 22:30811056-30811078 GAGATGAGTGAGATGGGGAGGGG - Intronic
1182656746 22:31896751-31896773 GAGAGAAATGTGATGGAGGAGGG - Intronic
1184975178 22:48056576-48056598 GAAATGAATGAAATGGAATATGG - Intergenic
1203286338 22_KI270734v1_random:156283-156305 GAGCACAAGGAGATGGAGTAAGG - Intergenic
950044898 3:9943308-9943330 GAGATGGACAAGATGGAGTCAGG + Intronic
950108963 3:10406259-10406281 GAAAAGAATGAGATGAAGTGTGG + Intronic
951496346 3:23331722-23331744 GAGATGAGAGAGAGGAAGTAGGG + Intronic
952303741 3:32127139-32127161 CAAATTGATGAGATGGAGTAGGG - Intronic
952724745 3:36572188-36572210 AAAATGATTGAGATGAAGTAGGG - Intergenic
953007302 3:38990276-38990298 GAGGTGAGTGAGATGCAGCAGGG - Intergenic
953272897 3:41463032-41463054 GGGAAGCATGAAATGGAGTAGGG + Intronic
953511279 3:43542288-43542310 GGGATGAATGAGAGGGAGGGAGG + Intronic
953530632 3:43736777-43736799 GAGACAAATGAGAAGGATTAAGG + Intergenic
954155052 3:48680801-48680823 GACATGGATGAGAGGGAGTGAGG - Intronic
954263308 3:49455418-49455440 GAGCAGAATGATCTGGAGTATGG - Intergenic
955207821 3:56912788-56912810 GAGGTGAGTGAGATGGGGAAAGG + Intronic
955540565 3:59971917-59971939 GGGAGAAATGAGATGGAATAAGG - Intronic
955663435 3:61325805-61325827 TGGATGAAAGAGAGGGAGTAAGG + Intergenic
957227372 3:77467361-77467383 GAGAAAAATGAGAAGCAGTAGGG + Intronic
957662228 3:83174187-83174209 AAAATGAATGAGATGGAAAAAGG - Intergenic
959871661 3:111335739-111335761 GAGATGAAAGGGATGGAGGTTGG - Intronic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960355507 3:116648022-116648044 GATATAAATAAGATGGAGCAAGG + Intronic
961494958 3:127284655-127284677 GAGTGTAAGGAGATGGAGTAGGG + Intergenic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
963060296 3:141220113-141220135 GACATGAATGAGGTTGAGGAAGG - Intergenic
963674233 3:148288252-148288274 GAGATGATAGAGATGAACTAGGG + Intergenic
963922305 3:150917460-150917482 CAGTTGAATGAGGTAGAGTAGGG - Intronic
964602989 3:158523769-158523791 GAGAGGAATGAGCAGGAGCATGG + Intronic
965355521 3:167668350-167668372 GAGACGAATGAGATGCAGACAGG - Intergenic
965777891 3:172252516-172252538 TACCTGAATGAGATGCAGTAAGG - Intronic
965887624 3:173467655-173467677 GAGATAAATGAGATAATGTATGG + Intronic
970531776 4:16992322-16992344 GAGATTACTGGGATGCAGTAAGG - Intergenic
972475315 4:39444436-39444458 GAGAAGAATGAGATGAAGGTGGG - Intronic
974250548 4:59378118-59378140 GAGAGAAAAGAGATGGAGTTTGG + Intergenic
975494631 4:75024294-75024316 CTGATTAATGACATGGAGTAAGG + Intronic
976629833 4:87224927-87224949 GAGATGGATGGGGTGGAGTTTGG + Intronic
976799776 4:88975812-88975834 GTGATGAGTGAGATAAAGTATGG + Intronic
976887484 4:90003591-90003613 GAGCTGGTTGAGATGGAGAAAGG + Intergenic
977443049 4:97094763-97094785 GACATGAGTGGGTTGGAGTATGG + Intergenic
977738717 4:100450014-100450036 AAGATGAATGCTATGGAATATGG + Intronic
978106714 4:104911617-104911639 GAGCAGAATGAGGTAGAGTAAGG - Intergenic
979218597 4:118194717-118194739 GAGATGAAGGAGACTGAGAATGG - Intronic
979274820 4:118803370-118803392 GAGGTGAATGTGCTGAAGTACGG - Intronic
982550162 4:156787712-156787734 GAGATGAATGAGATGGAGTAAGG + Intronic
983555466 4:169055560-169055582 GAGGTGAAGGAGAGGGAGAAGGG - Intergenic
983723303 4:170886427-170886449 GAGAGGAATTAGATGTAGAAAGG + Intergenic
984017530 4:174443621-174443643 GAGATGAAAGAAAAGGAGGAGGG - Intergenic
984487552 4:180391397-180391419 TAGATGAATGAGTAGAAGTAGGG + Intergenic
984626783 4:182016159-182016181 CAGATGACTGAGATGGTGTCTGG + Intergenic
985575993 5:673723-673745 GAGGTGAATGTGCTGGAGCAGGG + Intronic
985862141 5:2479539-2479561 GGGAAGAATGAGAGGGAGTGTGG + Intergenic
986010493 5:3710244-3710266 GAGATGCATTAGATGCATTATGG + Intergenic
986866799 5:11998779-11998801 GAGATGAAAGAGATGGCTAAAGG - Intergenic
987583105 5:19820882-19820904 GAGATGAATGTTATGTATTATGG - Intronic
987777853 5:22392628-22392650 GACTTGAATGAGATGAAGCATGG - Intronic
988459500 5:31420602-31420624 GAGAAGACTGAGAGGCAGTAGGG - Intronic
989075342 5:37559424-37559446 GAGATGAAGGAGGAGGAGAATGG - Intronic
989160249 5:38384117-38384139 GAGAGGAAGGAGAAGGAATAAGG + Intronic
990620288 5:57551506-57551528 GAGATGGATATGAGGGAGTAGGG + Intergenic
990720300 5:58687406-58687428 GATATGAATTAGATAGAATAGGG + Intronic
991022250 5:61991975-61991997 GAGAGAAATGAGATGGAGAAAGG + Intergenic
991663058 5:68969624-68969646 GAGCTGAATGTGATGGAGTGTGG - Intergenic
993788862 5:92181175-92181197 TTGATGAATTAGCTGGAGTATGG + Intergenic
993982665 5:94561291-94561313 GAGATGCATAAGATAAAGTAAGG - Intronic
995933607 5:117482394-117482416 GAGATGAATGAGATACAGTGTGG - Intergenic
996560741 5:124826276-124826298 GTGATGAGAGAGATGGAGTATGG + Intergenic
997415500 5:133725048-133725070 TAGATCAATGAAATGGAATAGGG - Intergenic
997496370 5:134330339-134330361 GAGAGGAATGAGCTGGAGCATGG + Intronic
997596344 5:135109643-135109665 GAATTGAATGAGATGAAGGATGG + Intronic
998704239 5:144740429-144740451 TAGACCCATGAGATGGAGTAAGG - Intergenic
999682456 5:154072840-154072862 GAGCTGAATTAGATAGAGTTGGG + Intronic
999719806 5:154391229-154391251 GAGATGAATCAGAGGGAATTCGG - Intronic
1001138611 5:169123980-169124002 GAGAGGAATGAGCAGGAGCATGG - Intronic
1002539400 5:179896051-179896073 GGGATGAAACCGATGGAGTAAGG - Intronic
1003331651 6:5134853-5134875 GAGAGGAAGGAGAAGGAATAGGG - Intronic
1003435926 6:6088021-6088043 GAGAAGAAAGAGAGGGAGAAGGG + Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1004187214 6:13431119-13431141 AAGAAGAATGAGTTGGAGAAGGG + Intronic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1006846756 6:37067550-37067572 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1008202444 6:48607688-48607710 GAGAAAACTGAGATGGAGCAAGG + Intergenic
1010754669 6:79653679-79653701 GTGAGGAAAGAGATGGGGTATGG + Intronic
1011421043 6:87173626-87173648 GAGATGAATGAAGTGGATGATGG - Intronic
1012438050 6:99235681-99235703 GAGATGGATGAGGTTGAGGATGG + Intergenic
1013291337 6:108721283-108721305 AAGATGATTGAGAGGGAGGATGG - Intergenic
1013460508 6:110370861-110370883 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1013684598 6:112564881-112564903 GAGATGAAGGAGATGAAGAAGGG + Intergenic
1013837047 6:114345010-114345032 AAGATGACTGAGAAGGAGGATGG + Intergenic
1013884108 6:114940994-114941016 GATATGACAGAGATGGAGGAGGG + Intergenic
1014273487 6:119360934-119360956 GAGATGAAGGTGCTAGAGTAGGG - Intergenic
1014353707 6:120377087-120377109 GAGATGAAAGAGATGAACTGAGG - Intergenic
1014855993 6:126401668-126401690 GAGATAAAGGAGATGGATTTGGG + Intergenic
1014870719 6:126593438-126593460 GAGTTAAATGAGATAGTGTATGG - Intergenic
1015337533 6:132057528-132057550 GTGATGAATGAGATAAAGTTTGG + Intergenic
1017056678 6:150443096-150443118 TAGATGAAGGGGAAGGAGTACGG - Intergenic
1017098161 6:150823736-150823758 GAGATGACAGAGATGGGGAAGGG - Intronic
1017573094 6:155769247-155769269 GAGATAAATGAAATTGAGTCTGG - Intergenic
1017701808 6:157081213-157081235 GGGTAGAATGAGATGCAGTAAGG + Intronic
1018617354 6:165700284-165700306 GAGAGGAAGGGGATGGGGTAGGG + Intronic
1019103544 6:169650613-169650635 GAGATGGATGAGTGGGAGCATGG - Intronic
1019103555 6:169650657-169650679 GAGATGGATGAGTTGGTGGATGG - Intronic
1020376159 7:7489826-7489848 GAGATGAATAGGATAGAGTGGGG - Intronic
1022812886 7:33886514-33886536 GAGGTGTATGAGATGGAGCTGGG + Intergenic
1023486383 7:40691811-40691833 GAGAGGAATGGCATGGAGTTTGG + Intronic
1023530107 7:41144197-41144219 GTGATGAAAGGGAAGGAGTATGG - Intergenic
1023623544 7:42095523-42095545 GAAATGAATGGGATGGAGGAGGG + Intronic
1024958791 7:54953957-54953979 GAGATGCAGGACATGGATTAGGG - Intergenic
1026836357 7:73642200-73642222 GAGATGCATGGGCTAGAGTATGG + Intergenic
1028618728 7:92800334-92800356 GAGATGAATGACATCACGTATGG - Intronic
1028800459 7:94958399-94958421 GAGGTGAATGAGATAGACAAGGG - Intronic
1030935399 7:115579985-115580007 GAGATAAATGTGTTGGAGGAGGG - Intergenic
1031023640 7:116655759-116655781 GACAGGAATGAGTTAGAGTAGGG + Intergenic
1033022562 7:137741102-137741124 GAGCTGAATGACTTGGAGCAAGG - Intronic
1033279531 7:139995895-139995917 GGGATGAATGAGAGGGAGCGAGG - Intronic
1033402424 7:141039322-141039344 GAGATGAATTACATGGAAGAAGG - Intergenic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1037023721 8:14006183-14006205 GAGATGTAAGAGGTGCAGTAAGG + Intergenic
1037216895 8:16465164-16465186 GAAATTACTAAGATGGAGTAGGG + Intronic
1037692457 8:21193762-21193784 GAGCTGAAAGAGAAGGAGGAAGG + Intergenic
1038651102 8:29404109-29404131 GAAATGAATGAGATGATTTAAGG + Intergenic
1040818140 8:51530215-51530237 AAGATGGATGAGATGGATTAGGG + Intronic
1042078913 8:65027870-65027892 GATATAAGTGCGATGGAGTAAGG + Intergenic
1042581785 8:70287533-70287555 GAGACGAATCAAAGGGAGTAGGG + Intronic
1042634218 8:70855390-70855412 GAAATGAATGAAATGAAGCAAGG + Intergenic
1044352870 8:91186813-91186835 GAGGTGGATGGGATGGAGGATGG + Intronic
1045000251 8:97871858-97871880 GACATGGATGAGATGGAGTTGGG + Intronic
1045772536 8:105760119-105760141 GATATGAATGACTTGGAGTAGGG + Intronic
1045857406 8:106780462-106780484 GAGAGGAATGGGATGGACCATGG - Intergenic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1048327576 8:133451132-133451154 GAGTTGAATGAGATGGTCCAAGG - Intergenic
1050629810 9:7546418-7546440 GGGAGGCATGAGATGGAGTTGGG + Intergenic
1051734703 9:20186495-20186517 GAGTTCAATGTGTTGGAGTAGGG - Intergenic
1053714673 9:40874863-40874885 GAAATGAATGAAATGAAGCAAGG + Intergenic
1054997084 9:71404426-71404448 GAGATGAATAAGTTAGAGGAAGG - Intronic
1056292618 9:85158907-85158929 AAGAGGAGTGAGCTGGAGTAGGG + Intergenic
1056492942 9:87125729-87125751 GAGATCAAAGAGTTGGAGTTTGG - Intergenic
1059235896 9:112760474-112760496 GAGATTTATGAGATGGATGATGG + Intronic
1060104362 9:120864180-120864202 GAGATGGAAGGGAGGGAGTAGGG - Intronic
1060809591 9:126603794-126603816 GGGATCTATGAGATGGAGAAGGG - Intergenic
1061688672 9:132306077-132306099 GAGTTGCATGGGATGGAGTAAGG - Intronic
1062028566 9:134351781-134351803 GAGGTGAATGACATGGAGTTGGG + Intronic
1203342857 Un_KI270442v1:10295-10317 GAAAGGAATGGAATGGAGTAGGG + Intergenic
1185872473 X:3675448-3675470 GAGAAGGAAGAGATGGAGGAGGG - Intronic
1185925666 X:4142868-4142890 AAGAAGAATGAGATGCAGTGGGG - Intergenic
1187520662 X:20011059-20011081 GAGATGAACGAGAGGGAGAGAGG + Intronic
1189171549 X:38914304-38914326 GAGCCCAATGAGATGGAGCACGG + Intergenic
1190598070 X:52066215-52066237 GAGAGGAAGGAGATGGGGGAGGG + Intronic
1190610754 X:52187858-52187880 GAGAGGAAGGAGATGGGGGAGGG - Intronic
1191932347 X:66387967-66387989 GAGATGAGTAATATGGGGTAGGG + Intergenic
1192669525 X:73125223-73125245 GAGGTGAAAGAGGAGGAGTATGG - Intergenic
1193607676 X:83588563-83588585 CAGCAGAATGAGATGGAGTTTGG - Intergenic
1194484228 X:94467369-94467391 GAGGAGGATGAGATGGAGAACGG + Intergenic
1196013030 X:110908361-110908383 GAACTGAAGGAGATGGAGAATGG - Intergenic
1197906098 X:131427352-131427374 GAGAAGGATGAGAAGGAGGAAGG - Intergenic
1197917471 X:131552163-131552185 AAGATGGCTGAGATGGAGTGGGG + Intergenic
1197964703 X:132046821-132046843 GAGATAAATGAAATGTAGTAGGG - Intergenic
1198482045 X:137050445-137050467 GTAATGAATGAGGGGGAGTAAGG - Intergenic
1200517993 Y:4172124-4172146 TAGATCAATGGGATAGAGTAAGG - Intergenic
1201127342 Y:10927060-10927082 CAGTGGAATGAAATGGAGTAGGG - Intergenic
1201136070 Y:10991077-10991099 GAGTGGAATGGGATGGAGTGAGG - Intergenic
1201136479 Y:10993930-10993952 GAGAGGAGTGATGTGGAGTAGGG - Intergenic
1201885590 Y:18878424-18878446 TTGATGAATTAAATGGAGTAGGG + Intergenic